Original Article
Considering Temozolomide as a Novel Potential Treatment for Esophageal Cancer ´ line Bruye ` re, MSc; Caroline Lonez, PhD2; Anaelle Duray, MD3; Ste ´ phanie Cludts, MD3; Jean-Marie Ruysschaert, PhD2; Ce 3 4 1 Sven Saussez, MD, PhD ; Paul Yeaton, MD, PhD ; Robert Kiss, PhD ; and Tatjana Mijatovic, PhD1
BACKGROUND: C-X-C ligand (CXCL) chemokines exert major roles in the biologic aggressiveness of esophageal cancer. In the current study, the authors investigated temozolomide (TMZ)-induced effects on activity of the CXCL chemokine network in human esophageal cancer cells. To the authors’ knowledge, TMZ has not been investigated previously in experimental or clinical esophageal cancers. METHODS: A complete mapping of CXCL chemokines and their receptor messenger RNA was performed in 2 established human esophageal cancer cell lines (OE21 and OE33) and in 4 surgical samples from patients with esophageal carcinoma. The analyses pointed out the potential importance of CXCL2, and monitoring CXCL2 with quantitative videomicroscopy indicated that its biologic activity was silenced in OE21 esophageal cancer cells. TMZ-mediated antitumor activity was determined in vivo in an OE21 metastatic nude mice xenograft model. RESULTS: The messenger RNA levels of CXC chemokines and their receptors were similar in both cell lines and in the 4 surgical specimens. CXCL2 depletion by small interfering RNA (siRNA) displayed marked effects on the proliferation of transfected OE21 cells. Chronic in vitro TMZ treatment of OE21 and OE33 cells markedly decreased CXCL2 and CXCL3 secretion. In vivo, TMZ induced significant delays in OE21 xenograft tumor development and improved the survival of OE21 xenograft-bearing mice, whereas cisplatin did not. Analyses performed on tissue samples from in vivo experiments revealed that TMZ also impaired tumor angiogenesis. CONCLUSIONS: The current study emphasized the role of proangiogenic chemokines in esophageal cancer biology and indicated the possibility of using TMZ as a clinically compatible drug to impair the actions of the CXCL chemokine network in C 2010 American Cancer Society. esophageal cancers. Cancer 2010;000:000–000. V KEYWORDS: C-X-C chemokine, chemokine receptor, esophageal cancer, temozolomide.
Despite decades of effort to improve outcomes, esophageal cancer remains a highly fatal disease. Annually, approxi-
mately 460,000 patients are diagnosed with esophageal cancer worldwide, and >380,000 patients die from this malignancy, which makes esophageal cancer the eighth most common cancer and sixth on the list of cancers that cause mortality.1 The overall 5-year survival rate for patients with esophageal cancer remains low because of late diagnosis, metastasis, and resistance of the tumor to radiotherapy and chemotherapy.2 Surgical resection as the treatment of choice remains a matter of debate, especially with modern strategies that incorporate neoadjuvant chemoradiation or perioperative chemotherapy for the treatment of locoregional disease. In fact, >50% of patients still have inoperable disease at presentation.1 A recently updated Cochrane review, which compared preoperative chemotherapy versus surgery alone and included 11 randomized trials that involved 2019 patients, ended with inconclusive evidence of a statistically significant benefit of standard chemotherapy.3 It is important to note that most of the standard agents (platines, taxanes, 5-fluorouracil) that have been used, in fact, are proapoptotic drugs and that esophageal cancers are naturally resistant to proapoptotic stimuli.3-6 Thus, novel therapeutic approaches are needed to combat esophageal cancers that display natural resistance to proapoptotic stimuli. Temozolomide (TMZ) significantly improves outcomes in patients with glioblastoma, a malignancy that represents another example of an apoptosis-resistant cancer that is associated with a dismal prognosis.7,8 Whole genomic analyses of TMZ-resistant glioma cells recently revealed, among other findings, increased expression levels of CXC chemokines.9 Corresponding author: Robert Kiss, PhD, Laboratoire de Toxicologie-Institut de Pharmacie, Universite´ Libre de Bruxelles, Campus de la Plaine-Boulevard du Triomphe, 1050 Brussels, Belgium; Fax: (011) 322-332-53-35;
[email protected] 1 Laboratory of Toxicology, Institute of Pharmacy, Free University of Brussels, Brussels, Belgium; 2Laboratory for Structural Biology and Bioinformatics, Free University of Brussels, Brussels, Belgium; 3Laboratory of Anatomy and Cellular Biology, University of Mons, Mons, Belgium; 4Divestive Health Center, University of Virginia Health System, Charlottesville, Virginia
R.K. is a Director of Research with the Fonds National de la Recherche Scientifique (FNRS), Belgium; and C.L. a Senior Research Assistant with the FNRS. DOI: 10.1002/cncr.25687, Received: April 20, 2010; Revised: July 13, 2010; Accepted: September 7, 2010, Published online in Wiley Online Library (wileyonlinelibrary.com)
Cancer
Month 00, 2010
1
Original Article
CXC chemokine ligands (CXCL) are a unique cytokine family that, based on structure/function and receptor binding/activation studies, exhibit either angiogenic or angiostatic biologic activity.10,11 Many cancers have a complex chemokine network that affects the transcription of target genes involved in cell invasion, motility, interactions with the extracellular matrix, and the survival of cancer cells.11,12 Numerous studies have demonstrated that CXCL7 is overexpressed in tumor cells in general (for a review, see Waugh and Wilson13) and in esophageal cancer in particular.14-17 The expression of CXCL12 and its receptor, CXCR4, reportedly play important roles in both esophageal squamous cell carcinoma and adenocarcinoma in relation to lymph node metastasis.18-21 Wang et al22 reported that CXCL1-CXCR2 and CXCL2-CXCR2 signaling contributes significantly to esophageal cancer cell proliferation and that this autocrine signaling pathway may be involved in esophageal tumorigenesis. Together, these data prompted us to seek a reliable experimental model for human esophageal cancer and to investigate 1) the importance of CXCLs in the biology of esophageal cancers, 2) TMZ-induced effects on CXCL expression, and 3) TMZ-induced antitumor effects on experimental esophageal cancers.
MATERIALS AND METHODS Cell Lines, Tissue Samples, Media, and Compounds Established cell lines
Two established human esophageal cancer cell lines were used in this study: the squamous cancer cell line OE21 (European Collection of Cell Cultures [ECACC] code 96062201) and the adenocarcinoma cell line OE33 (ECACC code 9607808), both obtained from SigmaAldrich (Bornem, Belgium). The cells were maintained in culture as detailed elsewhere.23 Esophageal cancer tissue samples
Four archived tissue samples from patients with esophageal squamous cell cancer were kindly provided by Professor Isabelle Salmon (Head of the Department of Anatomopathology at the Erasmus University Hospital, Free University of Brussels, Belgium). Compounds
TMZ was obtained from Schering Plough (Brussels, Belgium). Cisplatin was provided by Aldrich (Bornem, Belgium).
2
In Vitro Overall Cell Growth Determination Overall cell growth was assessed using the 3-(4,5-dimethylthiazol-2yl)-diphenyltetrazolium bromide colorimetric assay (Sigma-Aldrich), as detailed previously.23 Each assessment was carried out 6 times. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) and Quantitative RT-PCR Total RNA extraction, and standard and quantitative RTPCR were performed as detailed elsewhere.24 The primers that were used, along with the experimental conditions for each primer, were provided by Invitrogen (Carlsbad, Calif) and were selected using HYBSIMULATOR software (Advanced Gene Computing Technology, Irvine, Calif). All primers that were used are listed in Table 1. The primers that were used for b-actin detection were as follows: forward, 50 -AAATCGTGCGTGACATTAA GG-30 ; reverse, 50 -CTAAGTCATAGTCCGCCTAG-30 . Enzyme-Linked Immunosorbent Assays The CXC chemokines growth-related oncogenic b (GROb) and GROc from enzyme-linked immunosorbent assay (ELISA) construction kits (Antigenix America, Huntington Station, NY) were used in accordance with the manufacturer’s instructions for the quantification of human CXCL2 and CXCL3, respectively. The plates were coated with 1 lg/mL of capture antibody, and the tracer antibody was used at 0.25 lg/mL. Cell culture supernatants were collected after different treatments and times (as indicated in the figure legends), and multiple aliquots were taken and stored at 20 C until they were analyzed. The results from the ELISAs are represented as absorbance values. The concentrations of CXCLs are expressed as picograms per milliliter (pg/mL) and all samples were normalized to the cell count in the sample. Flow Cytometry Analysis for Acridine Orange Measurements TMZ anticancer effects can be induced by sustained autophagic processes,7 which can be assessed by quantifying acidic vesicular organelles (revealed as red fluorescence) after acridine orange (Sigma-Aldrich) staining.24 In acridine orange-stained cells, the cytoplasm and nucleus fluoresce green, and the acidic compartments fluoresce red. The intensity of the red fluorescence is proportional to the degree of acidity and the volume of acidic vesicular organelles, including autophagic vacuoles. TMZ-induced effects at the level of acidic vesicular organelles in OE21 and OE33 cancer cells were measured by flow cytometry,
Cancer
Month 00, 2010
` re et al CXCL Chemokines in Esophageal Cancer/Bruye
Table 1. Technical Details for Detecting C-X-C Ligand Chemokine (CXCL) and CXCL Receptor Expression by Reverse Transcription-Polymerase Chain Reaction Analysis
Targets (Synonym Names)
NCBI Sequence No.
Forward Primer Sequences
Reverse Primer Sequences
Annealing Temperature, Ca
CXCL1 CXCL2 CXCL3 CXCL4 CXCL5 CXCL6 CXCL7 CXCL8 CXCL9 CXCL10 CXCL11 CXCL12 CXCL13 CXCL14 CXCL16 CXCR1 CXCR2 CXCR3 CXCR4 CXCR5 CXCR6 CXCR7 KSHV Duffy
NM_001511 NM_002089 NM_002090 NM_002619 NM_002994 NM_002993 NM_002704 NM_000584 NM_002416 NM_001565 NM_005409 NM_199168 NM_006419 NM_004887 NM_001100812 NM_000634 NM_001557 NM_001504 NM_001008540 NM_001716 NM_006564 NM_020311 NM_024629 NM_002036
agggtatgattaactctacctg gtcaaacccaagttagttca agcttatcagcgtatcattgac ccagcgctgaagctggaagaagatgg agagtagaacctgggttaga ttgaaccctttggcaattg cttgtaggcagcaactca tgggtgcagagggttgtg gctttctaagatctaacaagatagc atgaatcaaactgcgattctgatt ggttaccatcggagtttaca atgaacgccaaggtcgtggtc ccctagacgcttcattga aagcttccgcttagaggt ctggactcagccaggcaatgg ggctgctggggactgtctatgaat gtaattacagttacagctctaccc tggacatcctcatggacctg atcttcctgcccaccatctactccatcatc agctatagacccgaggaa gtcatatccatcttctaccataagt tcaatcgcaactacaggtac tgttaccttctgaaactgtacc cttcctatggtgtgaatgattc
ccattaaacaaggcagtatgc cagtatgccttacaagaaagac ccctaacagtgatccactaa cttgtacagcggggcttgcaggtcc cctacaagccttttcacaag gggtaaagagtaacatattccc gcatacaagtcactgtctaga cagactagggttgccagattta ggaactagggagtttcatga ttaaggagatcttttagacatttc ccctacatattgatgtgctacatg cttgtttaaagctttctccaggtact ctcatgccttatttgtatggg cctaaggtttttgctgacagt tgagtggactgcaaggtgga gcccggccgatgttgttg gctaacattggatgagtagacg gaagtcagactgtgggcgaa atccagacgccaacatagaccaccttttca agcttgcgaggagatact aattgcctcgtcatggtaa atcaagacccgaagctac ggtgtaaattcaggagaaatcg aagagaggtctgaaaagcat
57.3 57 58.2 60 58 57.5 58 60 58.2 58 58.8 60 60 60 55 57 60 62 57 57.5 58.8 57 60 57.5
NCBI, National Center for Biotechnology Information; CXCL, C-X-C ligand chemokine; a, adenine; g, guanine; c, cytosine; t, thymine; CXCR, CXCL receptor; KSHV, Kaposi sarcoma-associated herpesvirus; Duffy, the Duffy antigen/chemokine receptor. a The thermal profiles were as follows: predenaturation for 10 minutes at 95 C, denaturation for 30 seconds at 95 C, annealing for 45 seconds at the temperatures indicated in this table, elongation for 45 seconds and 1 minute at 72 C, and a final elongation for 10 minutes at 72 C. The polymerase chain reaction products were obtained after 35 thermal cycles.
as detailed elsewhere.24 Each sample was evaluated in triplicate experiments. Flow Cytometry Analysis for Apoptosis Measurements Flow cytometry analyses of apoptotic cell death were carried out by using the terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick-end labeling (TUNEL) technique based on a previously detailed experimental protocol.25 Briefly, OE21 cells were treated with TMZ once at a concentration of 100 lM and also 5 times at the same concentration. Control cells were left untreated. Apoptosis was then assessed by using the flow cytometry-based TUNEL assay.25 Both nonadherent cells and adherent cells were harvested, pooled, and fixed overnight (for 15 hours) with 1% paraformaldehyde (for 1 hour) and 70% ethanol. The next day, the cells were processed using the APO-bromodeoxyuridine (BrdU) kit (Sigma-Aldrich) according to the manufacturer’s instructions. Immediately after the staining reaction, analysis was performed on a Cell Lab QUANTA flow cytometer
Cancer
Month 00, 2010
(Beckman Coulter, Analis, Suarlee, Belgium) equipped with a 488-nm argon laser. Apoptosis was quantified by following the increase in fluorescein isothiocyanate-deoxyuridine triphosphate labeling in TMZ-treated cells compared with that in control (untreated) cells. Immunofluorescence Analyses Cells were cultured on coverslips and fixed with 3.7% formaldehyde in phosphate-buffered saline (PBS) for 20 minutes at 4 C. Fixed cells were permeabilized for 20 minutes by the addition of 0.2% (volume/volume) Triton X-100 and 10% (weight/volume) bovine serum albumin. Cells were washed twice with PBS and blocked in PBS that contained 0.1% bovine serum albumin for 1 hour at room temperature. Cells were then stained for 1 hour at room temperature with a polyclonal antibody against GROb (CXCL2; 1:75 dilution) (Santa Cruz Biotechnology, Heidelberg, Germany). Antigens were detected using antigoat secondary antibody conjugated to Alexa Fluor 594 (Invitrogen). Coverslips were mounted on microscope slides with 10 lL Moviol agent (Calbiochem,
3
Original Article
VWR, Heverlee, Belgium). Images were captured using a 40 microscope immersion objective (Zeiss Observer.Z1; Zeiss, Oberkochen, Germany) and a software-controlled Axiocam HRm Zeiss camera. Images were converted to stacks and navigated using AxioVison software (release 4.6; Carl Zeiss MicroImaging GmbH, Hamburg, Germany).
Transient Knock-Down of C-X-C Ligand Chemokine 2 (CXCL2) Expression by Means of an Anti-CXCL2 Small Interfering RNA in Human OE21 Esophageal Cancer Cells The sequence of the CXCL2 siRNA (Eurogentec, Seraing, Belgium) that was used in the current work was 50 gcaucgcccaugguuaaga-30 for the sense sequence and 50 ucuuaaccaugggcgaugc-30 for the antisense sequence. An siRNA negative control (Eurogentec) was used as a process control. The antisense and sense strands of the siRNA were annealed by the manufacturer in 50 mM Tris, pH 7.5 to 8.0, and 100 nM NaCl in diethylpyrocarbonatetreated water. The final concentration of the siRNA duplex was 100 lM. Cells either were left untreated (wild-type [wt]) or were transfected with 3-tetradecylamino-N-tert-butyl-Ntetradecylpropionamidine (DiC14-amidine) lipoplexes with or without siRNA (negative control: scrambled siRNA [scr] or CXCL2-specific siRNA). DiC14-amidine synthesis and liposome preparations were described previously.26 To form lipoplexes, DiC14-amidine/siRNA at a DNA concentration of 0.4 lM (usually 200 lL) was added to an equal volume of liposomes at 20 lg diC14amidine/mL in RPMI medium (Invitrogen) while gently shaking the tube. The liposome/DNA mixture was allowed to stand for 20 minutes at room temperature before use. Under these conditions, the lipoplex has a cationic lipid/siRNA ratio of 7.5:1 (weight:weight), and the charge ratio was calculated as 4.54 positive charges for 1 negative charge. An additional lipid/siRNA ratio of 15:1 also was tested, and the charge ratio was calculated as 9.08 positive charges for 1 negative charge. The liposome/ DNA mixture was diluted in RPMI buffer (up to a concentration of 0.032 lM in siRNA) and added to OE21 cells for 2 hours. On Day 2, each group of cells was pooled and replated for subsequent experiments. On Days 3, 5, 7 and 9, esophageal cancer cells were scraped into cold PBS buffer (for RNA extraction), fixed on glass coverslips for immunofluorescence analyses, or lysed directly in Cellytic reagent (Sigma-Aldrich). The efficiency of the anti-
4
CXCL2 siRNA was evaluated by immunofluorescence analysis. Computer-Assisted Phase-Contrast Videomicroscopy The effects of anti-CXCL2 siRNA (vs control siRNA) on cell viability and cell growth were characterized in vitro by using computer-assisted, phase-contrast videomicroscopy, as described elsewhere.27,28 Software that was developed in our laboratory was used to quantify the percentage of the area that was filled by the cells over the period of the experiment.28 Cells were monitored from Day 3 to Day 9 post-transfection. Photomicrographs were taken twice daily (magnification, 10). Quantitative Immunohistochemistry The quantitative immunohistochemical assays have been described previously.29 For the current study, immunohistochemical labeling was performed using anti-inhibitor of differentiation 1 (anti-ID1) and anti-ID2 antibodies (dilution, 1:50) from Santa Cruz Biotechnology followed by staining with Meyer hematoxylin and Luxol Fast Blue. The ID-specific signals were evaluated quantitatively using a computer-assisted KS 400 imaging system (Carl Zeiss Vision, Hallbergmoos, Germany). Animal Models For the in vivo experimental models, 106 OE21 and OE33 cells were grafted subcutaneously into immunocompromized mice (6-week-old female nu/nu mice weighing 21-23 g; Janvier, Le Genest-St.-Isle, France). The potential therapeutic effects from chemotherapeutic agents were evaluated in the OE21 subcutaneous model. In the first assay, 5 mg/kg cisplatin was given as an intraperitoneal injection once weekly for 5 weeks. In the second experiment, 80 mg/kg TMZ was administered orally 3 times weekly for 6 weeks. Tumor size was measured twice weekly with calipers and is expressed as the area (in mm2) by multiplying the 2 greatest perpendicular dimensions. Each mouse was killed for ethical reasons when it had lost 20% of its weight compared with the maximal weight gained by the mouse during the experiment. The tumors were removed, fixed in buffered formalin for 5 days, embedded in paraffin, and cut into 5-lm-thick sections. Histologic slides were stained with hematoxylin and eosin for morphologic analyses and vessel counts, as described previously.30 Immunohistochemical analyses also were carried out as detailed above. All in vivo experiments described in this study were
Cancer
Month 00, 2010
` re et al CXCL Chemokines in Esophageal Cancer/Bruye
performed in accordance with Authorization LA1230509 from the Animal Ethics Committee of the Federal Department of Health, Nutritional Safety, and the Environment (Brussels, Belgium). Statistical Analysis All statistical analyses were performed using Statistica software (StatSoft, Tulsa, Okla) with the Mann-Whitney and Gehan-Wilcoxon tests.
RESULTS Establishment of an Experimental Model of Esophageal Cancer In vitro, the OE21 model (a squamous cell carcinoma) displayed higher proliferation rates and resistance to confluence in vitro than the OE33 model (an adenocarcinoma) (Fig. 1B). In vivo, OE21 xenografts also grew more rapidly than those formed by OE33 cells (Fig. 1C). Histopathologic analyses revealed that OE21 xenografts displayed highly invasive features toward surrounding murine host tissues (Fig. 1D) and metastasized to the lungs and liver (data not shown), whereas OE33 xenografts did not (Fig. 1D). Therefore, the OE21 xenograft model was selected for subsequent in vivo analyses. Determination of C-X-C Ligand Chemokine (CXCL) and C-X-C Chemokine Receptor (CXCR) Genomic Expression in Esophageal Cell Lines and Clinical Samples The patterns of CXCL and CXCR messenger RNA (mRNA) expression were determined (using the standard PCR techniques detailed in Table 1) in OE21 and OE33 human esophageal cancer cell lines and in 4 tissue samples from patients with esophageal squamous cell cancer (CS1-CS4). The results are summarized in Table 2 and include 1 example of how we quantified the patterns illustrated in Figure 2A. The mRNA expression patterns were classified as ‘‘’’ (absence of mRNA expression), ‘‘þ’’ (expression), and ‘‘þþ’’ (marked expression) for each of the 15 human CXCLs (CXCL15 is specific to rodents) and their 9 CXC receptors.10,11 These analyses revealed a similar expression pattern in the cell lines and the surgical specimens. Chemokines and receptors for which RNA expression was determined by using standard PCR methods at least in 1 of the 2 established cell lines were validated using quantitative RT-PCR (Fig. 2B). These investigations revealed the marked overexpression of proangiogenic chemokines, particularly CXCL1, CXCL2, and CXCL8 (Fig. 2B). Fig-
Cancer
Month 00, 2010
ure 2C provides a schematic illustration of the types of CXCL/CXCL receptor networks that were identified in the OE21 and OE33 models. Characterization of a Transient Knock-Down (Small Interfering RNA) of C-X-C Ligand Chemokine 2 Expression on the In Vitro Biologic Behavior of OE21 Cells Wang et al31 highlighted the central role of GRO/ CXCR2 signaling in maintaining the continued proliferation of esophageal cancer cells. In line with those findings, our objective was to further investigate the involvement/ role of CXCL2 in OE21 esophageal cancer cells using an siRNA approach and monitoring with computer-assisted videomicroscopy. Figure 3A indicates that untransfected cells (wt) and cells that were transfected with either empty cationic lipids or scrambled siRNA did not display any morphologic changes (Fig. 3A, brightfield photomicrographs), and the levels of CXCL2 remained unaltered. The 2 different siRNA:cationic liposome ratios that were used yielded similar results. Cells that were transfected with CXCL2 siRNA (in both ratios) displayed marked transient down-regulation of CXCL2 between Days 5 and 9 post-transfection (Fig. 3A). The transient depletion of CXCL2 had effects on the proliferation of transfected cell, as demonstrated by a decrease of approximately 50% in the global growth rate (in terms of cell numbers) of OE21 cells, and the effects remained after CXCL2 re-expression (Day 9 post-transfection) (Fig. 3B). Furthermore, transient CXCL2 depletion had a marked effect on the proliferation of transfected cells, as demonstrated by a reduction in their colonization capacity (Fig. 3C). Temozolomide Decreased C-X-C Ligand Chemokine (CXCL) and CXCL Messenger RNA Secretion by Esophageal Cancer Cells Figure 4A,B illustrates that the repeated (chronic) in vitro treatment of OE21 cells with TMZ (for 5 consecutive days) markedly decreased CXCL2 and CXCL3 mRNA and protein secretion (as evaluated by ELISA assay), whereas a single (1 day) in vitro treatment with TMZ did not significantly decrease CXCL2 and CXCL3 secretion. Similar data were obtained for OE33 cancer cells (data not shown). Figure 4C shows that both chronic treatment and single treatment did induce increases in acidic vesicular organelle amounts in OE21 cells that were treated 5 times with TMZ. Figure 4D shows that both chronic and single
5
Original Article
Figure 1. These charts and photomicrographs illustrate how reliable experimental models of esophageal cancer were set up. (A) These photomicrographs show the morphologic characteristics of the 2 human esophageal cancer cell lines (OE21 and OE33) that were used in the current study. (B) This chart illustrates the global growth characteristics displayed by OE21 and OE33 cells, as assessed by means of a colorimetric 3-(4,5-dimethylthiazol-2yl)-diphenyltetrazolium bromide assay over 12 days and using different starting cell concentrations, as indicated on each chart. (C) Tumor growth characteristics are charted from the in vivo subcutaneous OE21 and OE21 xenograft models in nude mice. Ten mice were grafted with each cell line. Tumor sizes are reported as mean standard error of the mean (SEM) values. (D) These are typical hematoxylin and eosin-stained examples of the histopathology and morphologic characteristics of tumors from 2 in vivo xenograft models (original magnification, 40).
6
Cancer
Month 00, 2010
` re et al CXCL Chemokines in Esophageal Cancer/Bruye
Table 2. Determining C-X-C Ligand Chemokine (CXCL) and CXCL Receptor Expression Levels in 4 Clinical Samples From Patients With Esophageal Cancers (CS1-CS4) and in 2 Established Human Esophageal Cancer Cell Lines (OE21 and OE33) by Reverse Transcriptase-Polymerase Chain Reaction Analysisa
Expression Level CXCL
CXCR
CXCL1 CXCR2 KSHV Duffy CXCL2 CXCL3 CXCL4 CXCL5 CXCL6 CXCR1 CXCL7 CXCL8 CXCL9 CXCR3 CXCL10 CXCL11 CXCR7 CXCL12 CXCR4 CXCL13 CXCR5 CXCL14 CXCL16 CXCR6
CS1
CS2
CS3
CS4
OE21
OE33
þ þ þ þþ þ þ þ þþ þþ þ þ þ þþ þ þ þþ þ
þþ þþ þ þ þþ þ þþ þ þ þ þþ þþ þþ þþ þþ þþ þþ þþ þ þþ þ
þþ þþ þ þ þþ þ þ þ þ þþ þþ þ þ þþ þ þ þþ þ þþ þ
þþ þþ þ þ þþ þ þ þ þþ þþ þþ þ þþ þþ þ þþ þþ þ
þ þþ þ þþ þ þ þþ þ þ þ þ þþ þ þþ þþ þþ þþ
þ þ þ þ þþ þ þ þ þ þþ þþ þ þ þþ þþ þþ
CXCL indicates C-X-C ligand chemokine; CXCR, CXCL receptor; þ, weakly positive, þþ, positive; , negative; KSHV, Kaposi sarcoma-associated herpesvirus; Duffy, the Duffy antigen/chemokine receptor. a For 1 experimental example, see Figure 2A.
treatments with 100 lM temozolomide induced apoptotic cell death in OE21 cancer cells 3 days after the last TMZ treatment. Temozolomide Contributes In Vivo Therapeutic Benefits in OE21 Esophageal Cancer Xenografts Cisplatin, a proapoptotic drug that is widely used to treat esophageal cancers, did not impair OE21 xenograft development or growth in immunocompromised mice (Fig. 5A). Accordingly, cisplatin was unable to contribute any significant therapeutic benefit in terms of overall survival in OE21 tumor-bearing mice (Fig. 5C). In contrast, we observed a significant delay in OE21 xenograft growth with TMZ using the same experimental model (P ¼ .02; Mann-Whitney test at Day 63, the last day all mice were alive) (Fig. 5B). OE21 xenograft-bearing mice that received TMZ treatment also displayed a significant improvement in overall survival compared with untreated mice (P ¼ .02; Gehan-Wilcoxon test) (Fig. 5D). It must be emphasized that, in cisplatin versus control experiments (Fig. 5A,C), the median survival of con-
Cancer
Month 00, 2010
trol mice was approximately 200 days; whereas, in TMZversus-control experiments (Fig. 5B,D), the median survival of control mice was
