Experimental Charcot–Marie–Tooth type 1A: A cDNA microarrays analysis

www.elsevier.com/locate/ymcne Mol. Cell. Neurosci. 28 (2005) 703 – 714

Experimental Charcot–Marie–Tooth type 1A: A cDNA microarrays analysis Tiziana Vigo,a,b,1 Lucilla Nobbio,a,b,1 Paul Van Hummelen,c Michele Abbruzzese,a,d GianLuigi Mancardi,a,b Nathalie Verpoorten,e Kristien Verhoeven,e Michael W. Sereda,f Klaus-Armin Nave,f Vincent Timmerman,e and Angelo Schenonea,b,* a

Department of Neurosciences, Ophthalmology and Genetics, University of Genova, Italy, via De Toni 5, 16132 Genova, Italy Center of Excellence for Biomedical Research, University of Genova, Italy, viale Benedetto XV, 16132 Genova, Italy c MicroArray Facility, Flanders Interuniversity Institute for Biotechnology, B-3000 Leuven, Belgium d Bioimaging and Molecular Physiology Institute, CNR, Genova, Italy e Department of Molecular Genetics, Flanders Interuniversity Institute for Biotechnology, University of Antwerp, Antwerpen, B-2610, Belgium f Department of Neurogenetics, Max-Planck Institute of Experimental Medicine, Hermann-Rein-Str. 3, D-37075 Gottingen, Germany b

Received 11 June 2004; revised 25 November 2004; accepted 30 November 2004

To reveal the spectrum of genes that are modulated in Charcot– Marie–Tooth neuropathy type 1A (CMT1A), which is due to overexpression of the gene coding for the peripheral myelin protein 22 (pmp22), we performed a cDNA microarray experiment with cDNA from sciatic nerves of a rat model of the disease. In homozygous pmp22 overexpressing animals, we found a significant down-regulation of 86 genes, while only 23 known genes were upregulated, suggesting that the increased dosage of pmp22 induces a general down-regulation of gene expression in peripheral nerve tissue. Classification of the modulated genes into functional categories leads to the identification of some pathways altered by overexpression of pmp22. In particular, a selective down-regulation of the ciliary neurotrophic factor transcript and of genes coding for proteins involved in cell cycle regulation, for cytoskeletal components and for proteins of the extracellular matrix, was observed. Cntf expression was further studied by real-time PCR and ELISA technique in pmp22 transgenic sciatic nerves, human CMT1A sural nerve biopsies, and primary cultures of transgenic Schwann cells. According to the results of cDNA microarray analysis, a down-regulation of cntf, both at the mRNA and protein level, was found in all the conditions tested. These results are relevant to reveal the molecular function of PMP22 and the pathogenic mechanism of CMT1A. In particular, finding a specific reduction of cntf expression in CMT1A Schwann cells suggests that overexpression of pmp22 significantly affects the ability of Schwann cells to offer a trophic support to the axon, which could be

* Corresponding author. Department of Neurosciences, Ophthalmology and Genetics, University of Genova, Italy, via De Toni 5, 16132 Genova, Italy. Fax: +39 010 3538639. E-mail address: [email protected] (A. Schenone). 1 The first two authors equally contributed to this project. Available online on ScienceDirect (www.sciencedirect.com). 1044-7431/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.mcn.2004.11.016

a factor, among other, responsible for the development of axonal atrophy in human and experimental CMT1A. D 2004 Elsevier Inc. All rights reserved.

Introduction Charcot–Marie–Tooth (CMT) disease, with a prevalence of 1 in 2500, is the most common inherited peripheral neuropathy. CMT is clinically and genetically heterogeneous, with autosomal dominant (AD), recessive and X-linked transmission subtypes (Dyck et al., 1993). Up to date more than 33 disease causing genes are known for CMT and related peripheral neuropathies (http://www.molgen. ia.ac.be/CMTMutations/). Based on clinical, neuropathological, and genetic data, CMT has been divided in different types. CMT type 1A (CMT1A) is an AD demyelinating neuropathy normally due to a duplication of a 1.4 Mb region in chromosome 17p11.2–12, containing the gene coding for the peripheral myelin protein 22 (PMP22) (Inoue et al., 2001). Point mutations in the PMP22 gene may also cause CMT1A (Roa et al., 1993; Valentijn et al., 1992). PMP22, a member of an extended family of tetraspan membrane proteins (Bolin et al., 1997; Magyar et al., 1997; Taylor et al., 1995), is highly expressed in myelinating Schwann cells and in compact myelin, where it represents 2–5% of total myelin proteins (Snipes et al., 1999; Suter and Snipes, 1995). Pmp22 expression has also been detected, during mouse development and in adulthood, in different neural and non-neural tissues (Baechner et al., 1995). Even if function and processing of PMP22 have been extensively studied, the molecular mechanisms underlying CMT1A are still unclear (Hanemann and Muller, 1998; Suter and Scherer, 2003).

704

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

Animal models of CMT1A have been developed (Huxley et al., 1996; Magyar et al., 1996; Perea et al., 2001; Sereda et al., 1996). Genetic characterization of pmp22 overexpressing nerves, in CMT1A rats (Sereda et al., 1996), shows that Schwann cells present abundant expression of genes encoding major structural myelin proteins and aberrant co-expression of early Schwann cell markers (Niemann et al., 2001). As cDNA microarrays technology allows large-scale, comparative gene expression profiling (Xiang et al., 2003) and has been recently used to study gene expression in Schwann cells and sciatic nerves of several animal models and in human nerves (Cameron et al., 2003; Costigan et al., 2002; Kubo et al., 2002; Nagarajan et al., 2001; Verheijen et al., 2003; Xiao et al., 2002), we performed a cDNA microarrays experiment on sciatic nerves from a rat model of CMT1A (Sereda et al., 1996) to reveal the complete spectrum of genes that are modulated in the disease. We found an altered expression level for 213 cDNA sequences, among which several genes involved in specific pathways that may be impaired in CMT1A. In particular, a selective down-regulation of the ciliary neurotrophic factor (cntf) transcript was observed. As cntf, which is produced by Schwann cells, specifically supports the survival of motor and sensory neurons as well as the myelination process (Sleeman et al., 2000; Stankoff et al., 2002), we further studied its expression in human and experimental CMT1A and in primary Schwann cells cultures from the CMT1A rat. We observed a general down-regulation of cntf in CMT1A nerves and Schwann cells. This result strongly suggests that pmp22 transgenic Schwann cells are unable to offer an adequate trophic support to the axon, leading to the late axonal atrophy observed in CMT1A nerves.

Results Microarrays analysis and expression study on selected genes In spite of the high sequence homology between mouse and rat genomes, preliminary hybridization was conducted to test the

mouse cDNA array MouseV (VIB) with the rat RNA (data not shown). Since these experiments showed that up to 80% of the spotted sequences could be hybridized by rat probes, we proceeded with testing gene expression in the pathological condition. We performed two biological repeats, and every hybridization was repeated in a dye swap. We considered up- or down-regulated cDNA sequences in transgenic sciatic nerves when changes in expression were greater than twofold compared to normal ones (Fig. 1). We found 213 cDNA sequences showing an altered expression in transgenic nerves. Of these 213 cDNA sequences, 145 correlated with 109 known genes and 68 with ESTs. The number of upregulated sequences was 55, referring to 23 known genes and 20 ESTs. Eighty-six known genes and 48 ESTs represented the group of 158 down-regulated cDNA. In the array, more than a single cDNA could represent a unique gene or an EST, so there was no correspondence between the number of regulated cDNAs and the genes. Considering the group of known genes, we observed that only 22.5% were up-regulated, while most of the genes (77.5%) were down-expressed. Furthermore, we classified the regulated genes into functional categories on the basis of literature and using Onto-Express database (Draghici et al., 2003) (Tables 1 and 2). Among the up-regulated ones (Fig. 2a), we found a predominance of genes coding for proteins involved in cell proliferation (16.7%), transcription factors (12.5%), translation factors (8.3%), and signal transducers (8.3%). The most representative categories in the down-regulated group (Fig. 2b) were the proteins involved in metabolic pathways (19.8%), integral membrane proteins (5.8%), muscle (9.3%) and extracellular matrix components (10.4%), and the cytoskeletal proteins (8.14%). Interestingly, we observed that genes related to a specific functional category tended to cluster among the up- or down-regulated ones (Fig. 3). Several genes, known to be down- or up-regulated in CMT1A, showed the expected pattern of expression. As previously observed (Niemann et al., 2001), we found an up-regulation of the transcription factor scip and of the mRNA coding for the low affinity nerve growth factor receptor (p75 ngfr ), which is normally

Fig. 1. (a) Scatter plot representing all the microarrays data. The duplicate spots were averaged. The color code in the picture is based on the significance level. The more red, the lower the P value. (b) Clones that were significant at the 5% level.

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

705

Table 1 List of the down-regulated known genes Apoptosis Cell proliferation Cytoskeleton

Extracellular matrix

Growth factors and receptor Integral membrane proteins

Ion transport

Kinases Metabolism

Mitocondria

Muscle proteins

Myelin

Accession no.

Short name

Description

Ratio

P value

BG069901 AA240923 W65025 AA231358 BG064035 BG073278 BG062944

Bok Gpc3 Jmj Cryab Pea15 Tpm1 Tpm2 Mtap1b

Bcl-2-related ovarian killer protein glypican 3 jumonji crystallin, alpha-B phosphoprotein enriched in astrocytes 15 tropomyosin 1, alpha tropomyosin 2, beta microtubule-associated protein 1 B tubulin alpha-4 tubulin, alpha-2 procollagen, type I, alpha-1 procollagen, type I, alpha-2 procollagen, type II, alpha-1 procollagen, type III, alpha-1 procollagen, type IV, alpha-1 procollagen C-proteinase enhancer protein fibulin 2 microfibrillar associated protein 5 spondin 2, extracellular matrix protein insulin-like growth factor 2 growth factor receptor bound protein 10 CD151 antigen CD9 antigen endothelial and smooth muscle cell-derived neuropilin-like glycoprotein, synaptic 2 mesothelin chloride intracellular channel 4 (mitochondrial) ATPase class I, type 8A, member 1 solute carrier family 21 member 11 SNF-related kinase acetoacetyl-CoA synthetase acetyl-coenzyme A synthetase 2 (ADP forming) acetyl-coenzyme A acetyltransferase 2 aldo-keto reductase family 1, member B3 aldolase 1, A isoform aldolase 3, C isoform creatine kinase, mitochondrial 2 ELOVL family member 6, elongation of long chain fatty acids enolase 3, beta muscle fatty acid synthase glyceraldehyde-3-phosphate dehydrogenase monoglyceride lipase malic enzyme, supernatant muscle glycogen phosphorylase farnesyl diphosphate farnesyl transferase 1 lipoprotein lipase stearoyl-coenzyme A desaturase 2 chaperone, ABC1 activity of bc1 complex like (S. pombe) cytochrome b-5 cytochrome b-561 monoamine oxidase A actinin alpha 2 myosin light chain, phosphorylatable, fast skeletal muscle myosin IB dysferlin troponin T1, skeletal, slow four and a half LIM domains 1 myozenin 1 titin immunoglobulin domain protein (myotilin) myelin protein zero periaxin rat PMP22 (peripheral myelin protein 22)

0.483 0.489 0.395 0.361 0.264 0.478 0.280 0.435 0.409 0.303 0.310 0.343 0.257 0.355 0.375 0.446 0.360 0.494 0.367 0.224 0.447 0.493 0.358 0.419 0.424 0.482 0.409 0.484 0.284 0.428 0.245 0.348 0.226 0.122 0.415 0.364 0.330 0.261 0.121 0.455 0.376 0.284 0.235 0.366 0.179 0.363 0.433 0.339 0.374 0.384 0.378 0.071 0.096 0.315 0.341 0.076 0.167 0.392 0.337 0.225 0.435 0.272

0.013 0.01 0.004 0.0002 0.015 0.028 0.002 0.006 0.01 0.003 0.005 0.0005 0.004 0.01 0.003 0.002 0.0004 0.001 0.0008 0.0007 0.0002 0.008 0.01 0.003 0.04 0.004 9.75E-05 0.04 0.012 4.44E-05 2.90E-05 0.0004 0.002 6.75E-06 0.002 0.002 0.008 0.02 1.64E-06 0.01 0.04 0.004 0.002 0.03 0.01 0.02 0.03 0.0005 5.26E-05 0.01 0.0007 0.002 1.84E-05 0.0004 0.004 0.0003 0.0001 0.019 0.04 0.037 0.003 0.006

M13444/M13446 BG064838 BG073196 BG073735 BG065049 W89883 BG072558 BG074851 BG073227 AA037995 BG073988 BG073613 BG065213 BG074882 W98963 BG065404 AA220458 BG074344 W12937 BG073152 BG067078 AA277366 BG073844 AA537637 BG073378 BG073739 BG065457 BG067158 W18057 BG064089 W11965 BG063838 AA122891 W17582 BG064680 W16286 BG069211 BG063416 BG064900 BG076219 BG065259 BG073138 BG065358 BG075715 AA032362 BG076112 BG064461 BG073597 AA047966 AA002733 AA510391 AA097191 BG072867

Tuba2 Col1a1 Col1a2 Col2a1 Col3a1 Col4a1 Pcolce Fbln2 Mfap5-pending Spon2 Igf2 Grb10 Cd151 Cd9 Esdn-pending Gpsn2 Msln Clic4 Atp8a1 Slc21a11 Snrk Aacs Acas2 Acat2 Akr1b3 Aldo1 Aldo3 Ckmt2 Elovl6 Eno3 Fasn Gapd Mgll Mod1 Pygm Fdft1 Lpl Scd2 Cabc1 Cyb5 Cyb561 Maoa Actn2 Mylpf Myo1b Dysf Tnnt1 Fhl1 Myoz1 Ttid Mpz Prx

(continued on next page)

706

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

Table 1 (continued)

Neurotrophic factor Transcription factors Signal transduction

Others

Accession no.

Short name

Description

Ratio

P value

AA543497 AA518455 W71604 AA217217 AA020462 BG063588 BG076141 BG075128 BG063515 AA049981 AA474937 BG063261 BG069748 BG073671 BG073463 BG073096 BG073341 AA461746 AA030949 BG067852 BG075594 BG066411 BG074009 BG076040 AA015155

Cntf Tcf4 Deaf1 Itpkb Rab2 Rhoip3-pending Chn1 Cetn2 Fth Gatm Epb4.1l2 H19 Lims2 Mfge8 Odf2 Olfm1 Rsdr1-pending Ssg1-pending Necl1-pending Pros1 Pxp-pending Serpine2 Uchl1 Zdhhc2 S100a3

ciliary neurotrophic factor transcription factor 4 deformed epidermal autoregulatory factor 1 (Drosophila) inositol 1,4,5-trisphosphate 3-kinase B RAB2, member RAS oncogene family rho interacting protein 3 chimerin 1 centrin 2 ferritin heavy chain glycine amidinotransferase erythrocyte protein band 4.1-like 2 H19 fetal liver mRNA LIM and senescent cell antigen like domains 2 milk fat globule-EGF factor 8 protein outer dense fiber of sperm tails 2 olfactomedin 1 retinal short-chain dehydrogenase/reductase 1 steroid-sensitive gene 1 nectin-lke 1 protein S (alpha) peroxisomal protein serine (or cysteine) proteinase inhibitor, clade E, member 2 ubiquitin carboxy-terminal hydrolase L1 zinc finger, DHHC domain containing 2 S100 calcium binding protein A3

0.075 0.440 0.256 0.498 0.437 0.412 0.486 0.441 0.258 0.383 0.474 0.435 0.134 0.434 0.406 0.487 0.496 0.458 0.284 0.211 0.375 0.406 0.461 0.497 0.322

6.15E-05 0.001 0.01 0.0006 0.002 0.016 0.019 0.008 0.004 0.002 0.001 0.0008 0.02 0.007 0.003 0.001 0.001 0.02 0.039 0.006 0.0004 0.017 0.0002

Several genes were represented in the array by more than one sequence; however, only one sequence is listed for each gene.

expressed by non-myelinating Schwann cells and immature Schwann cells precursors. Some genes known to carry point mutations responsible for other types of CMT, like the periaxin (prx) and the laminin A (lmna) (De Sandre-Giovannoli et al., 2002; Guilbot et al., 2001), were also differentially expressed. Moreover,

we identified a modulation of a few genes lying in chromosomal regions associated with different forms of dominant and recessive CMT (Table 3) (Berciano and Combarros, 2003). These genes may be studied, in the future, as positional candidate in mutational analysis.

Table 2 List of the up-regulated known genes Basal lamina Cell proliferation

Cytoskeleton Extracellular matrix Growth factors and receptor Integral membrane protein Myelin Poliamine catabolism Signal trasduction Transcription factors

Translation factors Others

Accession no.

Short name

Description

Ratio

P value

AA066180 BG070163 BG066310 AA272260

Lmna Ccnd1 Ccnd3 Csrp2

2.652 3.809 2.771 9.189

0.04 0.02 0.01 1.21E-05 0.0005

BG072743 BG074004 BG067727 AA048449 W12889 BG075879 BG072707 BG072288 AA013851 BG071421 BG065255 W14398 AA068436 BG069032 AA063753 BG069237 BG072800 W36002 BG066068 BG075959

Btg1 Vil2 Tnfrsf12a Ngfr Cdh3 Plp Sat Adcy9 Rap1ga1 Idb2 Scip Sox4 Bzw2 Gc20-pending Abca1 Abhd3 BC038058 Oraov1 Zfp216 Pcbp4

lamin A cyclin D1 cyclin D3 cysteine-rich protein 2 B-cell translocation gene 1, anti-proliferative villin 2 tumor necrosis factor receptor superfamily, member 12a nerve growth factor receptor cadherin 3 Proteolipid protein (myelin) spermidine/spermine N1-acetyl transferase adenylate cyclase 9 Rap1, GTPase-activating protein 1 inhibitor of DNA binding 2 POU domain, class 3, transcription factor 1 SRY-box containing gene 4 basic leucine zipper and W2 domains 2 translation factor sui1 homolog ATP-binding cassette, sub-family A (ABC1), member 1 abhydrolase domain containing 3 transcription termination factor, mitochondrial-like oral cancer overexpressed 1 zinc finger protein 216 poly(rC) binding protein 4

Several genes were represented in the array by more than one sequence, however only one sequence is listed for each gene.

2.842 2.371 5.256 3.160 2.476 2.198 3.837 2.027 2.402 2.423 9.077 2.526 3.710 3.667 3.999 2.076 2.048 2.753 2.686 2.094

0.002 0.005 0.005 0.04 0.022 0.001 0.045 0.006 0.0005 0.02 0.0005 0.01 0.004 0.04 0.02 0.004 0.001 0.012

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

707

both hemizygous and homozygous rats as compared to normal controls. A significant ( P b 0.05) down-regulation of the ciliary neurotrophic factor (cntf) and the cd9-antigen transcripts was observed only in the homozygous pmp22 overexpressing nerves, but the hemizygous ones also showed lower levels of these genes compared to normal controls. We also analyzed the expression levels of genes coding for other important neurotrophic factors using semiquantitative RT-PCR. We tested the expression of nerve growth factor (ngf), brain derived neurotrophic factor (bdnf), glial derived neurotrophic factor (gdnf), and neurotrophin 3 (nt3). The cDNA corresponding to those transcripts was spotted on the mouse gene chip but did not show altered expression in transgenic nerves. The results of the RT-PCR experiments (Fig. 4) confirmed that cntf is the only neurotrophic factor significantly down-regulated in pmp22 overexpressing nerves. Cntf expression in CMT1A

Fig. 2. Categorization of up-regulated genes (a) and down-regulated genes (b) into functional categories.

Genes involved in cell cycle (cyclin D1 and cyclin D3), in cell adhesion and motility (cd9-antigen), and trophic support (cntf) were selected to confirm the microarray results by semiquantitative RT-PCR reactions. We observed a full correspondence between levels of gene expression in microarray hybridization and semiquantitative RT-PCR (Table 4). A significant ( P b 0.05) upregulation of the cyclin (ccnd1 and ccnd3) transcripts was found in

Considering the strong and specific reduction of cntf mRNA in pmp22 overexpressing nerves, we further studied its expression in experimental and human CMT1A and in cultures of pmp22 overexpressing Schwann cells. In archived sural nerves, we could quantify by real-time PCR the CNTF mRNA in all normal controls. Instead, the transcript was not detectable in CMT1A nerves. To reliably compare cntf expression in human and experimental CMT1A, we repeated the transcript analysis, in rat sciatic nerves, by real-time PCR. Again, a down-regulation of cntf was found in pmp22 transgenic hemizygous (0.49 F 0.07) and homozygous (0.02 F 0.01) nerves compared to normal controls. As a reduced expression of cntf could be merely due to a loss of Schwann cells in CMT1A nerves, we counted Schwann cells number in pmp22 rat nerves and in normal controls. We did not observe any difference between homozygous (13.4 F 0.4 cells/ mm2), hemizygous (13.4 F 0.65 cells/mm2), and normal nerves (12.5 F 1.34 cells/mm2).

Fig. 3. Categorization of modulated genes from the most representative functional categories in the up (gray)- and down (white)-regulated groups. The percentage was calculated by division of the number of down- or up-regulated genes by the total number of genes in each category.

708

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

Table 3 Modulated genes lying in chromosomal regions associated with CMT Accession no.

Symbol

Name

Human chromosome

Disease

BG073735 AA461746 AA047966 AA240923 BG073597 AA002733 AA220458 AA013851 BG073341

Col2a1 Ssg1-pending Fhl1 Gpc3 Tnnt1 Myoz1 Gpsn2 Rap1ga1 Rsdr1-pending

procollagen, type I, alpha-2 steroid sensitive gene 1 four and a half LIM domains 1 glypican 3 troponin T1 myozenin 1 glycoprotein, synaptic 2 Rap1, GTPase-activating protein 1 retinal short-chain dehydrogenase/reductase 1

12q13 3q13 Xq26 Xq26 19q13 10q22 19p13 19p13 1p36

CMT2G HMSNP CMT2X CMT2X AR-CMT2B2 HMSNR DI-CMTB DI-CMTB DI-CMTC

HMSN-P: hereditary motor and sensory neuropathy, proximal type; HMSN-R: hereditary motor and sensory neuropathy, russe type; DI-CMTB: Charcot– Marie–Tooth neuropathy, dominant intermediate type B; DI-CMTC: Charcot–Marie–Tooth neuropathy, dominant intermediate type C.

CMT1A is well known, and an abnormal expression of a few genes coding for myelin proteins and Schwann cells differentiation markers has been previously described in pmp22 overexpressing rats (Niemann et al., 2001), little is known about the pathomechanisms underlying the disease and the effect of pmp22 overexpression on the transcriptional activity in the peripheral nervous system. We analyzed gene expression in nerves from 30-day-old rats, because at this age homozygous rats are easily distinguishable from hemizygous ones (Sereda et al., 1996) and their nerves show clear clinical, neuropathological, and neurophysiological abnormalities (Grandis et al., 2004). Our microarray experiment first indicates that the increased dosage of pmp22 induces a general down-regulation of gene expression in sciatic nerves. This observation may represent a generic damage to the nerve tissue by the genetic modification more than a specific consequence of pmp22 overexpression. We found only a minority of genes that were up-regulated in pmp22 transgenic rats. Among these, cyclin D1 and cyclin D3 mRNAs seem to be particularly interesting. D-type cyclins are required for the initial steps in cell division and nuclear import is crucial for the function of cyclin D1 in promoting cell proliferation. Myelinating Schwann cells express cyclin D1 in the perinuclear region, but after axons are severed, cyclin D1 is strongly up-regulated in parallel with Schwann cell proliferation and translocates into Schwann cell nuclei (Atanasoski et al., 2001). In pmp22 overexpressing rats an up-regulation in cyclin D1 expression was already found in the Schwann cells nucleus (Atanasoski et al., 2002). A cyclin D1 upregulation was also reported in peripheral nerves after axotomy (Kubo et al., 2002). Since the pmp22 gene shows homology to the growth arrest-specific gene gas3, an effect of pmp22 overexpression has been proposed on Schwann cells proliferation, but results are contrasting in this regard. In vitro experiments on PMP22 overexpressing human Schwann cells show a decreased

Furthermore, to evaluate the ability of pmp22 overexpressing Schwann cells to produce cntf in the absence of contaminating cells and independently to the axon, we analyzed cntf expression in short-term Schwann cells cultures. Again, real-time PCR was used to quantify cntf mRNA in normal and transgenic Schwann cells isolated from 30-day-old sciatic nerves (Nobbio et al., 2004). We observed that mRNA levels of cntf were reduced in hemizygous (0.7 F 0.06) and homozygous (0.53 F 0.07) transgenic cultures compared to normal ones. Using an ELISA method we also quantified the levels of cntf in sciatic nerves and in Schwann cells cultures. We observed a significantly ( P b 0.01) lower concentration of protein in sciatic nerves from homozygous (4.3 F 1.2 pg/Ag of total proteins) and hemizygous (14.18 F 1.7 pg/Ag of total proteins) pmp22 overexpressing nerves compared to normal controls (64.4 F 19.2 pg/Ag of total proteins). Moreover, we found a significant ( P b 0.01) decrease of cntf in homozygous (12.8 F 1.3 pg/Ag of total proteins) and hemizygous (18.3 F 0.3 pg/Ag of total proteins) purified Schwann cells compared to normal ones (47.9 F 0.8 pg/Ag of total proteins). We also quantified cntf protein in the culture medium, observing that in homozygous (2.6 F 0.6 pg/100 Al) and hemizygous (2.15 F 0.4 pg/100 Al) Schwann cells cntf releasing was significantly ( P b 0.01) reduced compared to control cultures (11.79 F 2.7 pg/100 Al). These results strongly support the hypothesis that pmp22 overexpressing Schwann cells are primarily unable to produce and release normal levels of cntf.

Discussion We used cDNA microarrays technology to perform a complete gene expression profiling in sciatic nerves of transgenic rats overexpressing pmp22. In fact, although the genetic cause of

Table 4 Differential gene expression by cDNA microarrays (expressed as the average of logarithms) and semiquantitative RT-PCR (expressed as ratio between the band intensity and ribosomal RNA 28S) Gene

Normal

Heterozygous

Homozygous

Microarray ratio homozygous/normal

cd9 cntf ccnd1 ccnd3 Animals tested

1.268 F 0.23 1.138 F 0.32 0.16 F 0.02 0.11 F 0.007 4

0.442 0.57 0.39 0.26 4

0.298 0.084 0.717 0.45 4

0.36 0.075 3.8 2.77

F F F F

0.09 0.19 0.11* 0.06*

RT-PCR tests were performed on four animals independently for each condition. * Statistical significance ( P b 0.05) obtained with ANOVA test.

F F F F

0.04* 0.01* 0.11* 0.15*

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

709

Fig. 4. RT-PCR analysis of neurotrophic factors expression. Representative gels from control (1), hemizygous (2), and homozygous (3) rat sciatic nerves. No significant differences were found, between groups, in mRNA expression of (a) BDNF (0.54 F 0.12 n. 4 vs. 0.77 F 0.26 n. 4 vs. 0.62 F 0.028 n. 4; n.s.); (b) GDNF (0.05 F 0.04 n. 4 vs. 0.34 F 0.18 n. 4 vs. 0.21 F 0.08 n. 4; n.s.); (c) NGF (0.31 F 0.12 n. 4 vs. 0.30 F 0.08 n. 4 vs. 0.28 F 0.12 n. 4; n.s.); (d) NT3 (0.75 F 0.15 n. 4 vs. 0.88 F 0.08 n. 4 vs. 0.5 F 0.2 n. 4; n.s.). On the contrary, CNTF transcript levels (e) were significantly higher in control nerves compared to homozygous ones (1.138 F 0.32 n. 4 vs. 0.57 F 0.19 n. 4 vs. 0.084 F 0.01 n. 4; P b 0.01).

proliferation (Hanemann et al., 1997). However, in a CMT1A animal model, a continued Schwann cell proliferation into adulthood was observed (Magyar et al., 1996). Our results, although insufficient to make any conclusion, are in keeping with the previous study (Atanasoski et al., 2002) showing that pmp22 overexpressing Schwann cells proliferate after demyelination. Moreover, we found a deregulation of other genes involved in negative modulation of cell proliferation, suggesting that in pmp22 overexpressing nerves impairment in the cell cycle regulation affects the resident proliferating cellular populations. Finally, among the up-regulated genes we identified several transcription factors (Idb2, Sox4, Scip). Further studies are needed to elucidate a possible role of these nuclear proteins in the Schwann cells biology. We found that a large group of down-regulated genes is involved in lipidic and glucidic metabolism. Impairment in the cholesterol biosynthesis pathways has been shown in telluriuminduced neuropathy (Harry et al., 1989), and the consequent lack of cholesterol destabilizes myelin (Wagner-Recio et al., 1991). Many genes directly involved in lipid metabolism have been found regulated by microarray analysis during myelination (Nagarajan et al., 2002; Verheijen et al., 2003), underscoring the relevance of Schwann cells cholesterol synthesis in myelination. Finding a down-regulation of genes coding for enzymes involved in cholesterol biosynthesis is consistent with the absence of myelin in homozygous transgenic rats. Genes coding for cytoskeleton components were also downregulated in homozygous transgenic nerves. It has been shown that pmp22 overexpression affects the differentiation and the spreading/ adhesion properties of Schwann cells (Brancolini et al., 2000; Magyar et al., 1996). Finding a diffuse down-regulation of cytoskeleton elements further supports the idea that overexpression of pmp22 induces changes in the ability of a Schwann cell to change its shape and switch on the myelination process (Nobbio et al., 2004). As Schwann cells are the highly predominant population in peripheral nerves and morphological abnormalities of other components of sciatic nerve, like axons, are not present at this age (Grandis et al., 2004), changes in transcriptional profile have to be

considered mainly caused by the imbalance in Schwann cell function. PMP22 is a tetraspan membrane protein (Bolin et al., 1997; Magyar et al., 1997; Taylor et al., 1995). Our microarray experiment shows a down-regulation of Cd9 mRNA, another tetraspan cell surface protein expressed in the peripheral nervous system by Schwann cells (Banerjee and Patterson, 1995; Kaprielian et al., 1995; Tole and Patterson, 1993). Down-regulation of cd9 could represent a defensive mechanism carried out by Schwann cells to counterbalance pmp22 overexpression. Gene compensation mechanisms occur in different models (Bowe et al., 2002; Groussin et al., 2000). We propose a similar mechanism to explain Cd9 loss in pmp22 overexpressing nerves. Cd9 was shown to be associated with h3, h6, and h1 integrins (Hadjiargyrou et al., 1996), and perturbation of its expression alters Schwann cell adhesion, proliferation, and migration as well as neurite outgrowth in sympathetic neurons (Anton et al., 1995; Hadjiargyrou and Patterson, 1995). Therefore, down-regulation of Cd9 could itself account for some of the shaping defects previously observed in pmp22 overexpressing Schwann cells (Brancolini et al., 2000; Nobbio et al., 2004). Another group of down-regulated genes was represented by extracellular matrix components such as collagens. In literature, contrasting results have been reported about expression of collagens in hereditary neuropathies of the CMT type. In human and experimental CMT1A an up-regulation of collagen types I, III, IV, V, and VI and an increased collagen deposition were, respectively, observed (Palumbo et al., 2002; Robaglia-Schlupp et al., 2002). Instead, in the sciatic nerves of Trembler-J mouse, which carries a point mutation in the pmp22 gene, a reduction of collagen IV was reported (Misko et al., 2002). Discrepancies in the animal species and in the disease stage may account for these differences. However, further studies are needed to elucidate the role of collagens in the development of CMT1A. The most interesting result of our cDNA microarrays experiment is the profound down-regulation of the cntf gene observed in homozygous CMT1A rats. Schwann cells are sources of cytokines and neurotrophins that can affect the survival, differentiation, and

710

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

growth of neurons (Bunge, 1993). Cntf is one of the most important neurotrophic factors produced by myelinating Schwann cells (Sendtner et al., 1990) and is also able to enhance myelin formation (Stankoff et al., 2002). Its levels dramatically fall in the early stages of Wallerian degeneration (Sendtner et al., 1990). A consistent reduction of the cntf transcript was also found in sciatic nerves from the Trembler mouse (Friedman et al., 1992). Accordingly, we found a dramatic decrease of the cntf mRNA and protein in pmp22 overexpressing nerves. Interestingly, cntf is the only neurotrophic factor to show a down-regulation, as expression of bdnf, gdnf, ngf, and nt3 does not change, as confirmed by RT-PCR analysis. We also found a complete absence of the CNTF transcript in sural nerve biopsies from CMT1A patients. Several reports described a reduction of CNTF expression in different neuropathies (Ito et al., 2001; Lee et al., 1996; Yamamoto et al., 2001, 2002), but a total absence of this neurotrophic factor in peripheral nerves was never found. Finding a normal number of Schwann cells in pmp22 overexpressing sciatic nerves, as previously observed in human CMT1A sural biopsies (Hanemann et al., 1997), excludes that the extreme reduction of CNTF expression is due to a loss of Schwann cells. Taken together, these results suggest that both in human and experimental CMT1A there is a deficiency in CNTF support from the Schwann cells to the axon, which could contribute to the development of the axonal atrophy, observed in the late stages of CMT1A (Sahenk et al., 1999; Sancho et al., 1999). In agreement with this hypothesis, we also showed that pmp22 overexpressing Schwann cells, besides expressing lower level of cntf transcript, also produce and release low levels of the protein. This happens both in the presence and absence of the axon, suggesting a primary inability of transgenic Schwann cells in the production of this specific neurotrophic factor. In conclusion, our study provides the first comprehensive list of genes showing altered expression levels in sciatic nerves of pmp22 transgenic rats. This gene expression profile suggests that pmp22 overexpression deeply alters the delicate balance regulating the Schwann cells proliferation and differentiation, as showed by the observation of a severe derangement in the expression of genes involved in cell cycle support and in the cytoskeletal organization. Moreover, finding reduced levels of cntf in CMT1A nerves and Schwann cell cultures suggests that the trophic support offered by pmp22 overexpressing Schwann cells to the axon is highly insufficient. Finally, since some of the modulated genes map into chromosomal regions linked to other types of hereditary neuropathies, our results might be of help in future mutational analysis to reveal new disease responsible genes.

Experimental methods Animal model We used 30-day-old homozygous transgenic rats overexpressing pmp22 (Sereda et al., 1996). Although the hemizygous condition is a more appropriate model of CMT1A, we compared homozygous rats with the normal controls, as we were interested in studying the general consequences of pmp22 overexpression on sciatic nerve mRNA profile. Next to homozygous animals, we also used hemizygous ones, when we looked at selected genes by semiquantitative RT-PCR, real-time PCR, and ELISA. Rearing

conditions were consistent with the guidelines of the Italian Health Ministry relating to the use and storage of transgenic organisms. RNA extraction Total RNA was obtained from sciatic nerves using standard methods to perform cDNA microarrays experiments. Eight sciatic nerves from sex-matched homozygous animals and four sciatic nerves from normal littermates were homogenized in TriPure Isolation Reagent (Boehringer Mannheim, Germany), with a Polytron homogenizer (Kinematica Srl, Italy) for 15 s. An equal volume of 70% ethanol was added to the watering phases deriving from chloroform extraction, and samples were transferred to Qiagen Rneasy Mini Kit columns (Qiagen SpA, Germany). The extraction proceeded according to the manufacturer instructions. Digestion of contaminant DNA was performed in the columns, using an RNAse-free DNAse (Qiagen SpA, Germany). Total RNA extraction was repeated two times to perform the microarray hybridization twice. The quality and the concentration of RNA were checked with NanoDrop Spectophotometer ND-1000 (Nano Drop Technologies Inc., Delaware, USA). cDNA microarray The mouse gene set consisted of five separate microarrays containing a total of 21,492 cDNA fragments from the 6K collection of Incyte (Mouse Gem I, Incyte, USA) and from the 15K collection of the National Institute of Aging (http:// lgsun.grc.nia.nih.gov). On each of the five slides, on average 4300 cDNAs were spotted in duplicate, distant from each other, on type VIIstar silane-coated slides (Amersham BioSciences, Buckinghamshire, UK). The cDNA inserts were PCR amplified using M13 primers, purified with MultiScreen-PCR plate (Millipore, Belgium), and arrayed in 50% DMSO on Type VII silane-coated slides (Amersham BioSciences, Buckinghamshire, UK) using a Molecular Dynamics Generation III printer (Amersham BioSciences). Slides were blocked in 2 SSPE, 0.2% SDS for 30 min at 258C. A minimum of 5 Ag total RNA was linearly amplified using in vitro transcription as previously described (Puskas et al., 2002). Briefly, RNA was reverse transcribed to double-stranded cDNA using an anchored oligo-dT + T7 promoter (5V-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-T24(ACG)3V) (Eurogentec, Belgium). From this cDNA, RNA was produced via T7-in vitro transcriptase until an average yield of 10–30 Ag amplified RNA (aRNA). From the aRNA, 5 Ag was labeled by reverse transcription using random nonamer primers (Genset, Paris, France), 0.1 mM d(G/T/A)TPs, 0.05 mM dCTP (Amersham BioSciences, UK), 0.05 mM Cy3-dCTP or Cy5-dCTP (Amersham BioSciences, UK), 1 first strand buffer, 10 mM DTT, and 200 Units of SuperScript II (Invitrogen, Belgium) in 20 Al total volume. The RNA and primers were denatured at 758C for 5 min and cooled on ice before adding the remaining reaction components. After 2 h incubation at 428C, mRNA was hydrolyzed in 250 mM NaOH for 15 min at 378C. The sample was neutralized with 10 Al of 2 M MOPS and purified with Qiaquick (Qiagen, Germany). The probes were resuspended in 210 Al hybridization solution containing 50% formamide, 1 hybridization buffer (Amersham BioSciences, UK), 0.1% SDS, and 60 Ag/ml poly-dT. Hybridization and post-hybridization washing were performed at 458C using an automated slide processor (ASP; Amersham BioSciences,

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

UK). Post-hybridization washing was performed in 1 SSC, 0.1% SDS, followed by 0.1 SSC, 0.1% SDS, and 0.1 SSC. The complete ASP program can be downloaded from www. microarrays.be (/technology/protocols). Arrays were scanned at 532 and 635 nm using a Generation III scanner (Amersham BioSciences, UK). Image analysis was performed with ArrayVision (Imaging Research Inc, Ontario, Canada). Two biological repeats and each hybridization were repeated in a dye swap. Spot intensities were measured as artifact removed total intensities, subtracted with the local background (sARVol), and filtered based on two standard deviations above background. For each gene, ratios of red (Cy-5) over green (Cy-3) intensities (I) were calculated and normalized via a Lowess Fit of the log2 ratios [log2(Icy-5 / Icy-3)] over the log2 total intensity [log2(Icy-5  Icy3)]. Mean ratios were calculated from the duplicate spots, and only values with covariance (CV) b0.5 were further taken into account. Normalized ratios that were statistical significant using a two-tailed t test (5% level) between the dye-swap repeat and higher than 1 or lower than 1 (log2 scale) were considered differentially expressed. Semiquantitative reverse transcriptase PCR To confirm the accuracy of cDNA microarrays, semiquantitative RT-PCR was performed on selected genes, known to be important in the biology of Schwann cells. Specific oligonucleotide primer pairs (Table 5) were designed using Primer 3 software (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) in order to amplify fragments of 180–250 bp in length. To avoid the amplification of contaminant genomic DNA, we selected primers lying on distinct exons. We performed RT-PCR on sciatic nerves from four different rats for genetic condition, each of them

Table 5 Oligonucleotide pairs used in semiquantitative RT-PCR experiments Gene Forward primers (5V–3V) Reverse primers (5V–3V) ccnd1 gcgtaccctgacaccaatct gaaccggtccaggtagttca ccnd3 tgcatctatacggaccaagctat aggtctgagcatgctttttga cntf gcaaacacctctgacccttc acggtaagcctggaggttct cd9 tgggattgttcttcggattc gctatgccacagcagttcaa bdnf acttttgagcacgtgatcgaaga ggtagttcggcattgcgagt gdnf ggacgggactctaagatgaagtt cgtcatcaaactggtcaggata ngf cacaggagcaagcgctcatc acacacacgcaggctgtatctatc Trkb cgacactcaggatttgtattgcc tccgtgtgattggtgacgtgtatt

711

coming from a different breeding. Results were expressed as the mean of the four animals. First-strand cDNA was synthesized from 250 ng of total RNA in a 30 Al reaction using the Superscript system (Invitrogen Srl, Italy). Semiquantitative amplification was performed from 10 Al of the first strand reaction. The product of the endogenous 18S RNA served as an internal standard. Amplification following hot start (5 min at 958C) was carried out for 20 cycles consisting of 1 min at 958C, 1 min at 568C, and 1 min at 728C; an additional extension time of 10 min was added. Preliminary experiments were conducted to ensure that measurements were performed in the exponential phase of amplification process and the expression of the reference gene was uniform in every condition. PCR products were analyzed on 2% agarose gels, and band intensity was measured on a Gel Doc 1000 image system (Bio-Rad, Hercules, CA). Results were expressed as ratio between specific band intensity and 18S RNA band. Real-time PCR cDNA was prepared from sciatic nerves of 30-day-old pmp22 overexpressing rats and their normal littermates and from primary Schwann cell cultures. Moreover, we analyzed human sural nerve biopsies from control subjects and patients with CMT1A. Total RNA was extracted as previously described from an independent pool of at least nine animals per genetic condition and from three human subjects per group. Relative quantification of expression of human and rat CNTF was performed using an ABI PRISM 7700 Sequence Detection System with SYBR green chemistry (Applied Biosystem) as described (http://www.docs.appliedbiosystems.com/ pebiodocs/04303859.pdf). Dissociation curve analysis was performed using Dissociation Curve 1.0 software (ABI) for each PCR reaction to detect and eliminate possible primer–dimer artefacts. Oligonucleotides were selected to amplify a fragment containing sequences from two adjacent exons in order to avoid contaminating genomic DNA amplification. To standardize the amount of cDNA in each reaction, we measured the amount of 18S rRNA, which showed no variation in expression in both human and animal samples. The comparative cycle threshold (Ct) method (User Bulletin 2, 1997; Applied Biosystems, Foster City, CA) was used to analyze the data by generating relative values of the amount of target cDNA. Relative quantification for cntf gene, expressed as fold variation over control, was calculated by the DDCt method, using control samples as calibrators. Human sural nerves biopsy Archived sural nerve biopsies, obtained for diagnostic purpose when the genetic diagnosis of CMT1A was not yet available, were used for this study. Negative controls are nerves that were biopsied in the suspect of a peripheral neuropathy but showed to be normal after morphological and morphometrical evaluation at the light and electron microscopy levels. Sural nerves were biopsied under local anesthesia at midcalf. Samples were snap frozen in liquid nitrogen and stored at 808C until used. Immunohistochemistry Rat sciatic nerves were fixed in 4% paraformaldehyde in sodium cacodylate 0.025 M for 18 h at room temperature and embedded in paraffin. Sections of 5 Am were digested with trypsin

712

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

for 15 min at 378C, then incubated with 10% normal goat serum in PBS for 15 min at room temperature. A mouse anti-rat S100 monoclonal antibody (Sigma-Aldrich, Saint Louis, Missouri, USA) was used 1:400 in PBS containing 1% normal goat serum and incubated over night at 48C in humid chamber. Sections were washed in PBS and incubated with biotinylated anti-mouse immunoglobulins (Biogenex Laboratories, San Ramon, CA) for 20 min at RT, then with peroxidase-conjugated streptavidin (Biogenex Laboratories, San Ramon, CA). The peroxidase activity was demonstrated using the DAB substrate (Biogenex Laboratories, San Ramon, CA). For each nerve fascicle three frames, randomly selected at a 20 magnification to cover at least 80% of the fascicle, were digitized and stored, using the Pro Plus Imaging System (Immagini e Computer, Rho, Italy). S100-positive cells were counted. We analyzed three sciatic nerves per genetic condition. Results are expressed as number of Schwann cells/mm2. Primary Schwann cells cultures Cell cultures were established from sciatic nerves of 30-day-old pmp22 transgenic homozygous and hemizygous rats according to a technique optimized for adult animals (Nobbio et al., 2004). Wild type rats from the corresponding genetic background were used as controls. Cntf expression and release were analyzed in Schwann cell cultures treated with serum-free medium containing 0.1% bovine serum albumin for 48 h. The supernatants were collected and frozen and, at the same time, Schwann cells were carefully rinsed with sterile phosphate-buffered saline (PBS), scraped from the culture dish, recovered through centrifugation, and immediately frozen. ELISA quantification Sciatic nerves and Schwann cells, scraped from the culture dish, were mechanically disrupted in PBS containing 0.1 mM PMSF. The extracts were obtained after two 15-min centrifugations at 100,000  g. Protein concentration in the supernatants was measured using Biorad Protein Detection kit (Bio-Rad Laboratories, Srl, Milan). Cntf content was determined by ELISA using a Rat Cntf DuoSet kit (R&D Systems, Inc, MN) according to manufacturer instructions. Briefly, mouse-anti-rat cntf capture antibody was coated at 2 Ag/ml into 96-well immunoassay plates (Corning Incorporated) overnight at room temperature. Then, plates were blocked with 1% BSA, 5% sucrose in phosphatebuffered saline (PBS, pH 7.4) for at least 1 h at room temperature, and washed with 0.01% Tween 20 in PBS (PBST). Sciatic nerve and Schwann cells extracts (10 Ag/well) were added to the plates and incubated at room temperature (RT) for 2 h. To quantify the cntf released in cultures medium, we tested 100 Al of the serum-free medium from Schwann cell cultures. Plates were washed three times with PBST between each assay step. Biotynilated goat anti-rat cntf detection antibody, diluted to 200 ng/ml with 1% BSA in PBST, was incubated in wells for 1 h at RT. The assay was developed with tetramethylbenzidine in phosphate buffer pH 6.0 and 0.1% H2O2 (R&D Systems, Inc, MN). Optical densities at 450 nm were measured using a spectrophotometric plate reader (Metertech). For sciatic nerves and Schwann cells extracts results were expressed as ratio between cntf and total proteins concentration. For the quantification of released cntf we normalized cntf concentration by the number of Schwann cells.

Statistical analysis Results were evaluated using a one-way analysis of variance (ANOVA), followed by a Dunnet post-test to separately compare the pathological conditions with the normal control.

Acknowledgments We thank Dr. Giulio Palmisano for help in RNA extraction. This work was financially supported by the European Science Foundation (ESF) Integrated Aproaches for Functional Genomics Program (L.N.); by Telethon contract GP02169 2002 (A.S.); by FISM 2001/R/59 (A.S.); by FIRB RBAUO1KJE4/002 (M.A.); and by COFIN-MIUR 2002 (M.A.). K.V. is a postdoctoral fellow of the Fund for Scientific Research, FWO-Flanders, and N.V. is received a PhD fellowship of the Institute for Science and Technology, IWT, Belgium.

References Anton, E.S., Hadjiargyrou, M., Patterson, P.H., Matthew, W.D., 1995. CD9 plays a role in Schwann cell migration in vitro. J. Neurosci. 15 (1 Pt. 2), 584 – 595. Atanasoski, S., Shumas, S., Dickson, C., Scherer, S.S., Suter, U., 2001. Differential cyclin D1 requirements of proliferating Schwann cells during development and after injury. Mol. Cell. Neurosci. 18 (6), 581 – 592. Atanasoski, S., Scherer, S.S., Nave, K.A., Suter, U., 2002. Proliferation of Schwann cells and regulation of cyclin D1 expression in an animal model of Charcot–Marie–Tooth disease type 1A. J. Neurosci. Res. 67 (4), 443 – 449. Baechner, D., Liehr, T., Hameister, H., Altenberger, H., Grehl, H., Suter, U., Rautenstrauss, B., 1995. Widespread expression of the peripheral myelin protein-22 gene (PMP22) in neural and non-neural tissues during murine development. J. Neurosci. Res. 42 (6), 733 – 741. Banerjee, S.A., Patterson, P.H., 1995. Schwann cell CD9 expression is regulated by axons. Mol. Cell. Neurosci. 6 (5), 462 – 473. Berciano, J., Combarros, O., 2003. Hereditary neuropathies. Curr. Opin. Neurol. 16 (5), 613 – 622. Bolin, L.M., McNeil, T., Lucian, L.A., DeVaux, B., Franz-Bacon, K., Gorman, D.M., Zurawski, S., Murray, R., McClanahan, T.K., 1997. HNMP-1: a novel hematopoietic and neural membrane protein differentially regulated in neural development and injury. J. Neurosci. 17 (14), 5493 – 5502. Bowe, D.B., Kenney, N.J., Adereth, Y., Maroulakou, I.G., 2002. Suppression of Neu-induced mammary tumor growth in cyclin D1 deficient mice is compensated for by cyclin E. Oncogene 21 (2), 291 – 298. Brancolini, C., Edomi, P., Marzinotto, S., Schneider, C., 2000. Exposure at the cell surface is required for gas3/PMP22 To regulate both cell death and cell spreading: implication for the Charcot–Marie–Tooth type 1A and Dejerine–Sottas diseases. Mol. Biol. Cell 11 (9), 2901 – 2914. Bunge, R.P., 1993. Expanding roles for the Schwann cell: ensheathment, myelination, trophism and regeneration. Curr. Opin. Neurobiol. 3 (5), 805 – 809. Cameron, A.A., Vansant, G., Wu, W., Carlo, D.J., Ill, C.R., 2003. Identification of reciprocally regulated gene modules in regenerating dorsal root ganglion neurons and activated peripheral or central nervous system glia. J. Cell. Biochem. 88 (5), 970 – 985. Costigan, M., Befort, K., Karchewski, L., Griffin, R.S., D’Urso, D., Allchorne, A., Sitarski, J., Mannion, J.W., Pratt, R.E., Woolf, C.J., 2002. Replicate high-density rat genome oligonucleotide microarrays reveal hundreds of regulated genes in the dorsal root ganglion after peripheral nerve injury. BMC Neurosci. 3 (1), 16.

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714 De Sandre-Giovannoli, A., Chaouch, M., Kozlov, S., Vallat, J.M., Tazir, M., Kassouri, N., Szepetowski, P., Hammadouche, T., Vandenberghe, A., Stewart, C.L., Grid, D., Levy, N., 2002. Homozygous defects in LMNA, encoding lamin A/C nuclear-envelope proteins, cause autosomal recessive axonal neuropathy in human (Charcot–Marie–Tooth disorder type 2) and mouse. Am. J. Hum. Genet. 70 (3), 726 – 736. Draghici, S., Khatri, P., Bhavsar, P., Shah, A., Krawetz, S., Tainsky, M.A., 2003. Onto-Tools, The toolkit of the modern biologist: Onto-Express, Onto-Compare, Onto-Design and Onto-Translate. Nucleic Acids Res. 31 (13), 3775 – 3781. Dyck, P.J., Chance, P., Lebo, R., Carney, J.A., 1993. Hereditary motor and sensory neuropathies. In: Dyck, P.J., Thomas, P.K., Griffin, S.W., Low, P.A., Poduslo, J.F. (Eds.), Peripheral Neuropathy, 3rd ed. WB Saunders, Philadelphia, pp. 1094 – 1136. Friedman, B., Scherer, S.S., Rudge, J.S., Helgren, M., Morrisey, D., McClain, J., Wang, D.Y., Wiegand, S.J., Furth, M.E., Lindsay, R.M., et al., 1992. Regulation of ciliary neurotrophic factor expression in myelin-related Schwann cells in vivo. Neuron 9 (2), 295 – 305. Grandis, M., Leandri, M., Vigo, T., Cilli, M., Sereda, M.W., Gherardi, G., Benedetti, L., Mancardi, G., Abbruzzese, M., Nave, K.A., Nobbio, L., Schenone, A., 2004. Early abnormalities in sciatic nerve function and structure in a rat model of Charcot–Marie–Tooth type 1A disease. Exp. Neurol. 190 (1), 213 – 223. Groussin, L., Massias, J.F., Bertagna, X., Bertherat, J., 2000. Loss of expression of the ubiquitous transcription factor cAMP response element-binding protein (CREB) and compensatory overexpression of the activator CREMtau in the human adrenocortical cancer cell line H295R. J. Clin. Endocrinol. Metab. 85 (1), 345 – 354. Guilbot, A., Williams, A., Ravise, N., Verny, C., Brice, A., Sherman, D.L., Brophy, P.J., LeGuern, E., Delague, V., Bareil, C., Megarbane, A., Claustres, M., 2001. A mutation in periaxin is responsible for CMT4F, an autosomal recessive form of Charcot-Marie-Tooth disease. Hum. Mol. Genet. 10 (4), 415 – 421. Hadjiargyrou, M., Patterson, P.H., 1995. An anti-CD9 monoclonal antibody promotes adhesion and induces proliferation of Schwann cells in vitro. J. Neurosci. 15, 574 – 583. Hadjiargyrou, M., Kaprielian, Z., Kato, N., Patterson, P.H., 1996. Association of the tetraspan protein CD9 with integrins on the surface of S-16 Schwann cells. J. Neurochem. 67 (6), 2505 – 2513. Hanemann, C.O., Muller, H.W., 1998. Pathogenesis of Charcot–Marie– Tooth 1A (CMT1A) neuropathy. Trends Neurosci. 21 (7), 282 – 286. Hanemann, C.O., Gabreels-Festen, A.A., Stoll, G., Muller, H.W., 1997. Schwann cell differentiation in Charcot–Marie–Tooth disease type 1A (CMT1A): normal number of myelinating Schwann cells in young CMT1A patients and neural cell adhesion molecule expression in onion bulbs. Acta Neuropathol. (Berl) 94 (4), 310 – 315. Harry, G.J., Goodrum, J.F., Bouldin, T.W., Wagner-Recio, M., Toews, A.D., Morell, P., 1989. Tellurium-induced neuropathy: metabolic alterations associated with demyelination and remyelination in rat sciatic nerve. J. Neurochem. 52 (3), 938 – 945. Huxley, C., Passage, E., Manson, A., Putzu, G., Figarella-Branger, D., Pellissier, J.F., Fontes, M., 1996. Construction of a mouse model of Charcot-Marie-Tooth disease type 1A by pronuclear injection of human YAC DNA. Hum. Mol. Genet. 5 (5), 563 – 569. Inoue, K., Dewar, K., Katsanis, N., Reiter, L.T., Lander, E.S., Devon, K.L., Wyman, D.W., Lupski, J.R., Birren, B., 2001. The 1.4-Mb CMT1A duplication/HNPP deletion genomic region reveals unique genome architectural features and provides insights into the recent evolution of new genes. Genome Res. 11 (6), 1018 – 1033. Ito, Y., Yamamoto, M., Mitsuma, N., Li, M., Hattori, N., Sobue, G., 2001. Expression of mRNAs for ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), interleukin-6 (IL-6), and their receptors (CNTFR alpha, LIFR beta, IL-6R alpha, and gp130) in human peripheral neuropathies. Neurochem. Res. 26 (1), 51 – 58. Kaprielian, Z., Cho, K.O., Hadjiargyrou, M., Patterson, P.H., 1995. CD9, a major platelet cell surface glycoprotein, is a ROCA antigen and is expressed in the nervous system. J. Neurosci. 15 (1 Pt. 2), 562 – 573.

713

Kubo, T., Yamashita, T., Yamaguchi, A., Hosokawa, K., Tohyama, M., 2002. Analysis of genes induced in peripheral nerve after axotomy using cDNA microarrays. J. Neurochem. 82 (5), 1129 – 1136. Lee, D.A., Gross, L., Wittrock, D.A., Windebank, A.J., 1996. Localization and expression of ciliary neurotrophic factor (CNTF) in postmortem sciatic nerve from patients with motor neuron disease and diabetic neuropathy. J. Neuropathol. Exp. Neurol. 55 (8), 915 – 923. Magyar, J.P., Martini, R., Ruelicke, T., Aguzzi, A., Adlkofer, K., Dembic, Z., Zielasek, J., Toyka, K.V., Suter, U., 1996. Impaired differentiation of Schwann cells in transgenic mice with increased PMP22 gene dosage. J. Neurosci. 16 (17), 5351 – 5360. Magyar, J.P., Ebensperger, C., Schaeren-Wiemers, N., Suter, U., 1997. Myelin and lymphocyte protein (MAL/MVP17/VIP17) and plasmolipin are members of an extended gene family. Gene 189 (2), 269 – 275. Misko, A., Ferguson, T., Notterpek, L., 2002. Matrix metalloproteinase mediated degradation of basement membrane proteins in Trembler J neuropathy nerves. J. Neurochem. (83), 885 – 894. Nagarajan, R., Svaren, J., Le, N., Araki, T., Watson, M., Milbrandt, J., 2001. EGR2 mutations in inherited neuropathies dominant-negatively inhibit myelin gene expression. Neuron 30 (2), 355 – 368. Nagarajan, R., Le, N., Mahoney, H., Araki, T., Milbrandt, J., 2002. Deciphering peripheral nerve myelination by using Schwann cell expression profiling. Proc. Natl. Acad. Sci. U. S. A. 99 (13), 8998 – 9003. Niemann, S., Sereda, M.W., Suter, U., Griffiths, I.R., Nave, K.A., 2001. Uncoupling of myelin assembly and Schwann cell differentiation by transgenic overexpression of peripheral myelin protein 22. J. Neurosci. 20 (11), 4120 – 4128. Nobbio, L., Vigo, T., Abruzzese, M., Levi, G., Brancolini, C., Mantero, S., Grandis, M., Benedetti, L., Mancardi, G.L., Schenone, A., 2004. Impairment of PMP22 transgenic Schwann cells differentiation in culture: implications for Charcot-Marie-Tooth type 1A disease. Neurobiol. Dis. 16 (1), 263 – 273. Palumbo, C., Massa, R., Panico, M.B., Di Muzio, A., Sinibaldi, P., Bernardi, G., Modesti, A., 2002. Peripheral nerve extracellular matrix remodeling in Charcot-Marie-Tooth type I disease. Acta Neuropathol. (Berl) 104 (3), 287 – 296. Perea, J., Robertson, A., Tolmachova, T., Muddle, J., King, R.H., Ponsford, S., Thomas, P.K., Huxley, C., 2001. Induced myelination and demyelination in a conditional mouse model of Charcot–Marie–Tooth disease type 1A. Hum. Mol. Genet. 10 (10), 1007 – 1018. Puskas, L.G., Zvara, A., Hackler Jr., L., Micsik, T., van Hummelen, P., 2002. Production of bulk amounts of universal RNA for DNA microarrays. BioTechniques 33(4), 898-900, 902, 904. Roa, B.B., Garcia, C.A., Pentao, L., Killian, J.M., Trask, B.J., Suter, U., Snipes, G.J., Ortiz-Lopez, R., Shooter, E.M., Patel, P.I., et al., 1993. Evidence for a recessive PMP22 point mutation in Charcot–Marie– Tooth disease type 1A. Nat. Genet. 5 (2), 189 – 194. Robaglia-Schlupp, A., Pizant, J., Norreel, J.C., Passage, E., Sabe´ranDjoneidi, D., Ansaldi, J.L., Vinay, L., Figarella-Branger, D., Le´vy, N., Clarac, F., Cau, P., Pellissier, J.F., Fontes, M., 2002. PMP22 overexpression causes dysmyelination in mice. Brain (125), 2213 – 2221. Sahenk, Z., Chen, L., Mendell, J.R., 1999. Effects of PMP22 duplication and deletions on the axonal cytoskeleton. Ann. Neurol. 45 (1), 16 – 24. Sancho, S., Magyar, J.P., Aguzzi, A., Suter1, U., 1999. Distal axonopathy in peripheral nerves of PMP22-mutant mice. Brain 122 (Pt 8), 1563 – 1577. Sendtner, M., Kreutzberg, G.W., Thoenen, H., 1990. Ciliary neurotrophic factor prevents the degeneration of motor neurons after axotomy. Nature 345 (6274), 440 – 441. Sereda, M., Griffiths, I., Puhlhofer, A., Stewart, H., Rossner, M.J., Zimmerman, F., Magyar, J.P., Schneider, A., Hund, E., Meinck, H.M., Suter, U., Nave, K.A., 1996. A transgenic rat model of Charcot-Marie-Tooth disease. Neuron 16 (5), 1049 – 1060. Sleeman, M.W., Anderson, K.D., Lambert, P.D., Yancopoulos, G.D., Wiegand, S.J., 2000. The ciliary neurotrophic factor and its receptor, CNTFR alpha. Pharm. Acta Helv. 74 (2-3), 265 – 272.

714

T. Vigo et al. / Mol. Cell. Neurosci. 28 (2005) 703–714

Snipes, G.J., Orfali, W., Fraser, A., Dickson, K., Colby, J., 1999. The anatomy and cell biology of peripheral myelin protein-22. Ann. N. Y. Acad. Sci. 883, 143 – 151. Stankoff, B., Aigrot, M.S., Noel, F., Wattilliaux, A., Zalc, B., Lubetzki, C., 2002. Ciliary neurotrophic factor (CNTF) enhances myelin formation: a novel role for CNTF and CNTF-related molecules. J. Neurosci. 22 (21), 9221 – 9227. Suter, U., Scherer, S.S., 2003. Disease mechanisms in inherited neuropathies. Nat. Rev., Neurosi. 4, 714 – 726. Suter, U., Snipes, G.J., 1995. Peripheral myelin protein 22: facts and hypotheses. J. Neurosci. Res. 40 (2), 145 – 151. Taylor, V., Welcher, A.A., Program, A.E., Suter, U., 1995. Epithelial membrane protein-1, peripheral myelin protein 22, and lens membrane protein 20 define a novel gene family. J. Biol. Chem. 270 (48), 28824 – 28833. Tole, S., Patterson, P.H., 1993. Distribution of CD9 in the developing and mature rat nervous system. Dev. Dyn. 197 (2), 94 – 106. Valentijn, L.J., Baas, F., Wolterman, R.A., Hoogendijk, J.E., van den Bosch, N.H., Zorn, I., Gabreels-Festen, A.W., de Visser, M., Bolhuis, P.A., 1992. Identical point mutations of PMP-22 in Trembler-J mouse and Charcot-Marie-Tooth disease type 1A. Nat. Genet. 2 (4), 288 – 291.

Verheijen, M.H., Chrast, R., Burrola, P., Lemke, G., 2003. Local regulation of fat metabolism in peripheral nerves. Genes Dev. 17 (19), 2450 – 2464. Wagner-Recio, M., Toews, A.D., Morell, P., 1991. Tellurium blocks cholesterol synthesis by inhibiting squalene metabolism: preferential vulnerability to this metabolic block leads to Peripheral nervous system demyelination. J. Neurochem. 57 (6), 1891 – 1901. Xiang, Z., Yang, Y., Ma, X., Ding, W., 2003. Microarray expression profiling: analysis and applications. Curr. Opin. Drug Discovery Devel. 6 (3), 384 – 395. Xiao, Y., Segal, M.R., Rabert, D., Ahn, A.H., Anand, P., Sangameswaran, L., Hu, D., Hunt, C.A., 2002. Assessment of differential gene expression in human peripheral nerve injury. BMC Genomics 3 (1), 28. Yamamoto, M., Ito, Y., Mitsuma, N., Li, M., Hattori, N., Sobue, G., 2001. Pathology-related differential expression regulation of NGF, GDNF, CNTF, and IL-6 mRNAs in human vasculitic neuropathy. Muscle Nerve 24 (6), 830 – 833. Yamamoto, M., Ito, Y., Mitsuma, N., Li, M., Hattori, N., Sobue, G., 2002. Parallel expression of neurotrophic factors and their receptors in chronic inflammatory demyelinating polyneuropathy. Muscle Nerve 25 (4), 601 – 604.