Extensive analysis of nuclear cistron rDNA sequence of Paracyclopina nana (Cyclopoida: Cyclopettidae)

Hydrobiologia (2011) 666:3–9 DOI 10.1007/s10750-010-0563-6

COPEPODA: BIOLOGY AND ECOLOGY

Extensive analysis of nuclear cistron rDNA sequence of Paracyclopina nana (Cyclopoida: Cyclopettidae) Jang-Seu Ki • Heum Gi Park • Jae-Seong Lee

Published online: 30 November 2010 Ó Springer Science+Business Media B.V. 2010

Abstract As a special reference of the nuclear cistron rDNA of cyclopoid copepods, we obtained the entire DNA sequence of a single rDNA repeat unit from Paracyclopina nana (Cyclopoida: Cyclopettidae). The genomic organization of P. nana rDNA (7,974 bp, 51.7% of GC) was observed to be 18S– ITS1–5.8S–ITS2–28S–IGS in order. Comparative analyses of the rDNA between P. nana and other copepods showed that the intergenic spacer (IGS) was highly informative and divergent, while other coding regions are relatively conserved. We detected eleven poly(T) tracts in the IGS, demonstrating the high AT content in this region. In addition, many sub-repeat

Guest editors: L. Sanoamuang & J.S. Hwang / Copepoda: Biology and Ecology J.-S. Ki Department of Green Life Science, College of Convergence, Sangmyung University, Seoul 110-743, South Korea J.-S. Ki  J.-S. Lee (&) National Research Lab of Marine Molecular and Environmental Bioscience, Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791, South Korea e-mail: [email protected] H. G. Park (&) Faculty of Marine Bioscience and Technology, College of Life Sciences, Kangnung National University, Gangneung 210-702, South Korea e-mail: [email protected]

sequence patterns (e.g., AG, AT, GC, CCG, TC) such as microsatellites were identified from the rDNA IGS of P. nana. In this article, we show the first complete sequence of rDNA from the order Cyclopoida, providing a better understanding of molecular characteristics in molecular taxonomy. Keywords Copepod  Cyclopoid  Nuclear rDNA  Paracyclopina nana  Transcription repeat unit

Introduction Cyclopoid copepods are an abundant and successful group, particularly in continental but also in marine waters (Copepod Web Portal (CWP) http://www. luciopesce.net/copepods/index.html). They play an important role as the first link in aquatic food chains from microscopic phytoplanktonic algae to fishes. The order Cyclopoida includes more than 1,500 species and subspecies, and approximately half of them belong to the family Cyclopidae. Traditionally, the systematics of cyclopoid copepods have been based on morphological characteristics, particularly at the genetic level (Kiefer, 1927; Rylov, 1948; Yeatman, 1959; Dussart, 1969; Monchenko, 1974). Over time, the phylogenetic relationships of the Cyclopoida and other copepods have been subjected to numerous revisions based on morphology, but they have remained unclear and controversial (Reid 1994;

123

4

Fiers et al. 1996). Recently, Dussart & Defaye (2006) have proposed a more acceptable taxonomic system for cyclopoid species. According to CWP, 81 families have been described morphologically to date without molecular character sets, such as information from ribosomal DNA (rDNA). The nuclear rDNA in eukaryotes is typically composed of tandem arrays of a basic unit that contains the transcription units (18S, 5.8S, 28S) and an intervening intergenic spacer (IGS) region. The rDNA cistron consists of many regions, resulting in two different properties; one is the coding region, which is essential for ribosomal functioning (Raue´ et al., 1990), while the others are non-coding regions. The different subunits and regions of the rDNA gene, therefore, have different degrees of sequence variation, providing suitability for comparison at the inter-genetic or interspecies level. So far, the phylogenetic relationships of only a few copepod groups have been studied with DNA sequences (Braga et al., 1999; Bucklin et al., 2003; Huys et al., 2006, 2007; Song et al., 2008). Recently, Huys et al. (2006, 2007) reported on the phylogenetic relationships of the orders Cyclopoida, Monstrilloida, Siphonostomatoida within the copepod lineage using complete 18S rDNA sequences. In addition, mitochondrial cytochrome c oxidase subunit I (COI) sequences have been studied (unpublished data in GenBank records). To date, genetic information (e.g., chromosome numbers, electrophoresis data, and mitochondrial genome) from only a few cyclopoid species have been revealed and little attention has been paid to molecular studies of the Cyclopoida. In this study, we report the complete nucleotide sequence of a single unit of tandemly repeated rDNA from the cyclopoid copepod Paracyclopina nana Smirnov 1935 (Cyclopinidae), and we characterize molecular features of various DNA regions of rDNA. In addition, comparative analyses of the P. nana rDNA were accessed from GenBank rDNA sequences in order to better understand the rDNA characteristics within cyclopoid copepods. Paracyclopina nana is one of the planktonic brackish water cyclopoid copepods with a high tolerance to salinity and temperature ranges (Lee et al., 2006). This kind of copepod species is an important food source for many developing juvenile fish larvae and crustaceans (Sun & Fleeger, 1995; Pinto et al., 2001). Recently, we sequenced the complete mitochondrial genome of P. nana (Ki et al., 2009a).

123

Hydrobiologia (2011) 666:3–9

Materials and methods Tissue sample and genomic DNA extraction Paracyclopina nana was collected with a mesh net in the coastal waters of Gangneung (37°480 0500 N, 128°540 3700 E), Korea, in December 28, 2000, and has been cultured since then in the laboratory. The specimens were preserved in 95% ethanol and samples were stored at -20°C until DNA extraction. Total genomic DNA of P. nana was isolated from the stored samples using the DNeasy tissue kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. Long-accurate polymerase chain reaction (LA-PCR) and DNA sequencing Polymerase chain reaction (PCR) primers (Table 1) were designed for the amplification of the entire rDNA unit sequence based on certain conserved rRNA coding gene sequences among invertebrates. These included the harpacticoid copepod Tigriopus japonicus Mori, 1938 (EU054307), Cyclops kolensis Lilljeborg, 1901 (EF532820), Cyclops insignis Claus, 1857 (EF532821), cnidarian Aurelia sp. Pe´ron & Lesueur, 1810 (EU276014), and Atolla vanhoeffeni Russell, 1957 (AY026368). The primer combinations (viz. Cop18F24/Cop28R765, Cop28F250/Cop28R3K, and Cop28F3K/Cop18R600) were used for LA-PCR amplification of the entire rDNA, either in one or several overlapping fragments. LA-PCR was performed with 50 ll reaction mixtures containing 30.5 ll sterile distilled water, 5 ll 109 LA-PCR buffer II (TaKaRa, Japan), 8 ll dNTP mix (4 mM), 5 ll of each primer (5 lM), 0.5 ll LA Taq polymerase (2.5 U), and 1 ll of template. PCR cycling was performed in a Bio-Rad iCycler (Bio-Rad, CA, USA) with 94°C for 2 min, following 35 cycles of 94°C for 20 s, 55°C for 30 s, and 72°C for 5 min, with a final extension at 72°C for 10 min. Resulting PCR products were electrophoresed in a 1.0% agarose gel (Promega, WI, USA), stained with ethidium bromide, and visualized by ultraviolet transillumination. PCR amplicons were then purified with QIAquick PCR purification Kit (Qiagen GmbH, Germany). DNA sequencing reactions were performed in an ABI PRISMÒ BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems, CA) using the

Hydrobiologia (2011) 666:3–9

5

Table 1 Primers used for long-PCR and sequencing (Seq.) of complete rDNA unit from P. nana Primer

Nucleotide sequence (50 –30 )

Cop-18F24 Cop-28R765

Location

Application(s)

TGGTTGATCCTGCCAGTAG

18S (5–23)

L-PCR/Seq.

TTGGTCCGTGTTTCAAGACG

18S (727–746)

L-PCR/Seq.

Cop-28F250 Cop-28R3K

AGTCGAGTTGTTTGGGAG-TACAGC ACCTGCGGTTCCTCTCGTAC

28S (267–286) 28S (3205–3224)

L-PCR/Seq. L-PCR/Seq.

Cop-28F3K

CAGGGATAACTGGCTTGTGG

28S (2994–3013)

L-PCR/Seq.

Cop-18R600

TATTGGAGCTGGAATTACCG

18S (577–596)

L-PCR/Seq.

Pn-18SF1750

AAAGTCGTAACAAGGTTTCCG

18S (1762–1782)

Seq.

Pn-18F798

GTGCATGGAATAATGGAATAGG

28S (803–824)

Seq.

Pn-28F1390

GAACCGAACGCTGAGTTAAA

28S (1261–1280)

Seq.

Pn-IGSR1

CACCAAGTCCAGACTGACCG

28S (1815–1834)

Seq.

Pn-IGSR2

CACAAGTCCCAGAAACTCGG

IGS (1389–1408)

Seq.

Pn-IGSF1

AGCGCGAGTGTTCTGCC

IGS (79–95)

Seq.

Pn-IGSF2

TTCTTTCATCTATCTCTGCATG

IGS (660–681)

Seq.

Pn-IGSR3

GAGACATGTGAGGATGCATG

IGS (1185–1204)

Seq.

Locations refer to the P. nana rDNA numbering (GenBank Accession no. FJ214952) revealed here F forward primer, R reverse primer, S sequencing primer

PCR products (2 ll) as a template and 10 pM of sequencing primers (Table 1). Labeled DNA fragments were analyzed on an automated DNA sequencer (Model 3700, Applied Biosystems, CA). Editing and contig assembly of the rDNA sequence fragments were carried out with Sequencher 4.7 (Gene Codes, MI, USA). The coding rDNA genes were identified with the NCBI database and the harpacticoid T. japonicus (EU054307). The sequence determined here has been deposited in GenBank, Accession no. FJ214952.

Comparative analysis of P. nana rDNA General molecular features of the P. nana rDNA were calculated by Genetyx ver.7.0 (Hitachi Engineering Co. Ltd., Japan) and MEGA ver.4.0 (Tamura et al., 2007). The repeat sequence pattern in the rDNA IGS sequences was analyzed using the Genetyx 7.0 Tandem Repeats Finder (http://tandem.bu.edu/trf/trf. basic.submit.html), and microsatellite repeats finder (http://biophp.org/minitools/microsatellite_repeats_ finder/demo.php). For comparison, the rDNA of P. nana was compared with that of other cylopoids (e.g., Cyclops kolensis, Cyclopidae sp.). Genetic distance values were calculated by using pairwise sequences among the cyclopoids with the Kimura

two-parameter model in DNASIS ver.3.5c, and molecular similarity was measured in BioEdit 5.0.6. In addition to this, dot-plot analysis was carried out using MegAlign 5.01 software (DNAstar Inc., WI, USA).

Results The complete sequence and organization of P. nana rDNA The total length of a single rDNA repeat unit from P. nana was determined to be 7,974 bp. It was organized in the typical eukaryotic fashion of rDNA (i.e., 18S–ITS1–5.8S–ITS2–28S–IGS) as shown in Fig. 1. Three rRNA coding genes (18S, 5.8S, 28S rDNA) are separated with internal transcribed spacers (ITS) and an IGS, respectively. Specifically, the DNA sequence of each P. nana rDNA locus was 1,808 bp (18S rDNA), 299 bp (ITS1), 157 bp (5.8S rDNA), 216 bp (ITS2), 3,572 bp (28S rDNA), and 1,922 bp (IGS). High GC contents were at ITS1 (65.2%) and ITS2 (60.0%), and low GC was at IGS (48.4%). Composition of total nucleotides of P. nana rDNA (7,974 bp) was measured at 22.8% of A, 25.3% of T, 27.8% of G, and 23.9% of C, respectively. Overall, the GC content was 46.5% (AT, 53.5%); the adenine (A) content in each rDNA locus was low.

123

6

(A)

Length=1,922 GC %=48.4

1,808 bp 49.0 %

IGS (ETS+NTS) 28S

299 65.2

ITS1 18S

51.0 157

Single unit of rDNA 60.0 216

Fig. 1 Schematic diagram of the single transcription repeat unit of rDNA (A) and IGS nucleotide sequence (B) of Paracyclopina nana. Solid boxes indicate the ribosomal genes, and thin lines represent ITS or IGS. Nucleotide sequences, in length and GC composition of each locus, are represented on/under the line after calculation from a single unit of rDNA (GenBank accession no. FJ214952). In the IGS sequence, a putative termination signal (poly‘‘T’’ track) is represented under a dotted line in bold. Certain repeats are indicated by underlines (e.g., R1, 2, 3, 4, 5) and microsatellite-like nucleotides are marked by dotted lines

Hydrobiologia (2011) 666:3–9

3,572 54.2

2

5.8S

28S

1 kb

(B) -70 GTCGTACTTGGTAGAGCAGCTACCATACTGCGATCTATTGAGACTCAGCCCTTTTGACTGGAAGATTTGT 1 71 141 211 281 351 421 491 561 631 701 771 841 911 981 1051 1121 1191 1261 1331 1401 1471 1541 1611 1681 1751 1821

IGS CTTGTCAGCTAGACAAGTCCTCCTCTCAAGGGCAGCTGCTAAGGAGGGAAGAAAAAGGCAGAGCATTCGC GCTTCAACAGCGCGAGTGTTCTGCCTTTTTTATTTGGCAAAGTTTTTTTTTTTCGCACAAGTCCTGGATA GAGTCGTTTCCTCCGTTCCGCCGCCGCCACTGGGCAGGTGAAAAAATCACAAGTCCCAGGGGGGGGAAAA R1 R2 TTATTCTCGAAATTTTCACCAAGTTCCGCGCGTCTAGTCGTTTCCTCCGTTCCGCCGCCGGGCGGTTGAA R3 R1 AAAAAAAATCACAAGTTTCGGGGGTCCTCCCGTTTCCTCCGTTTGCGGAAACGCCGCCCTGATGAAAAAA TCACAAGTCCCAGCTAGGGGAAAAATTTGTCACCATCACCAAGTTCCGCGCGTCTAGTCGTTTCCTCCGT R2 R3 TTTGGCGCCGGCCAGTTTGAAAAGTAGCACAGCATGAGCAGCCTCCTCCGAGCAGCCCGAGCAGTGCAAG CAACCTCGGCCTCACTGCCACTCGTAGCAGCAGCTTGCTGACGATGATGATGCTGCTTAAGTTGTGTTGT TTCCAGACTTGTGAACCCGAGACACTAGGCTTAACAATTATTCACTGTTTCTCACTAGTGACACATTCAT TTTTTGCAGCAAGCAAGCTATCTATCCATTTCTTTCATCTATCTCTGCATGAAACATAAACTCCTTTGCT GCATGCTATGTACCAAGACACAGCTAAACGTGATTTTTTTCATAATTTTTTCATGTGCTCTTTTTTGTTC CTCTGCAGCAAATATGTGCTCCTCTGCTACAAATTGGCATTTTCCTGAGCAGAGGCAATTTTTTTTTCTG R4 TTCTCGTGTCTGCGCATGAAAAATTCATATGTTTTTTTTTTATCCTCGCATATCCCCGCATGAAATATAT R5 GCTCCCCTGCCTGAATCGAGGGAGCGGACCACTTTTCAAGAGTTTTGGGACTTGGCAGTTTTTCCTCTAC TTTGGACTTACCCAATTTTCCCCCTCTTGGGGACTAAACAAAATTTCACCTTCCCGGGAACTTGTAATTT TTTTGGCAATTTTCAACTTTTTTTTTTTGGTGCCTTTGCATCAAATATGTGCTCCTCTGCTGCAAATTGG R4 CCCTTTCCTGAGCAGAGGCAAATTTTTTTTTTTTCTCATGTCTCCGCATGAAAAACCATTTTTTCATGCA R6 TCCTCACATGTCTCCGCATGAAATATATGCTCCTCTGCATGAATCGAGGGAGTGGGCCACTTTTCATGAA R6 R5 TTTGTGGACTTGGCAGTTTTTCATGCATTTTGGACTTAGCCAAATTTCCGCCTCTTGGGGACTTAGCCAA ATTTCAGCTTTTCTGGGACTTGTGAATTTTTGCGATTTTCTGGGACTTAGCCAAAATTCCGAGTTTCTGG GACTTGTGATTTTTCAGTGGCCATGTGGGAACCGCGTGCAGGGCCGCCATTGCCGCATAGGCTGGGCGGC AGAGTTCACCTGCCATGTTAGAGAGTGAGTGCAGCGGGTGCAATGTTATCACCTGTCACAGGCTGTTTTG GCTAACATGAGGAGGAAAGCTGAGAGCGCGAATGCGCGCGTCTCGGCGATCTCTCCGTCAGGACGGCGAG AGCGCGAGTATGGCGCGTTAAGCGCGCTAGTTAGAAGTACTCACACGCGTTCCACAGATGTTGTGTCTCG GTGGATTTTGTTCTCCGTGCGACGGCCGCTCGCGTCATTGGCGCGCAGATCGTTGATGGACGGGCAAAGT CGTTTGTTGTCGAGCTACGCAGTGCGTGGCTGAGCTGAGAAAAGGCTGAACGCGGCGCGAGTCGCGGTCA GTCTGGACTTGGTGAAAAATTTTCAAAACTTGGGTTTCGGCGCGGCGGCTCTTAGCGGCCGTTGCGTCCG

1891 TCGAACCTCGTGACGAATATTTTTCCGATAGTTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTC IGS

Patterns of the P. nana rDNA IGS The P. nana rDNA IGS contained 1,922 nucleotides, and their frequencies were measured as A, 21.4%; T, 30.2%; G, 23.9% and C, 24.4%. AT content (51.6%) was slightly higher than GC (48.3), due to at least 11 poly(T) tracts in the IGS (Fig. 1B). Of them, a poly‘‘T’’ tract (11 nucleotides) that was positioned within 113–123 bp of the rDNA IGS was associated with a putative termination signal of rRNA transcription, considering the typical structure of the poly-‘‘T’’ tract near the terminus of the 28S rDNA 30 end. On the other hand, we found many sub-repeat sequence patterns (Table 2) within the rDNA IGS region of

123

P. nana. Some of them (e.g., AG, AT, GC, CCG, TC) were similar to those of certain microsatellite patterns. The calanoid copepod Calanus finmarchicus Gunnerus, 1765 (GenBank Accession no. X06056) encodes the 5S rRNA in the rDNA IGS region (Drouin et al., 1987). Comparison with the 5S rDNA database (http://rose.man.poznan.pl/5SData/) could not identify a pattern of 5S rDNA sequences in P. nana rDNA IGS. Comparative analyses of entire rDNA The P. nana rDNA sequence was compared with those of other cyclopoid copepods, including Cyclops

Hydrobiologia (2011) 666:3–9

7

Cyclopoida (Paracyclopina nana) Table 2 Microsatellite-like patterns in the rDNA IGS of P. nana Cycle

Repeats

Sequence (50 –30 )

1489

2

3

AGAGAG

515

3

3

AGCAGCAGC

904

2

3

ATATAT

1212

2

3

ATATAT

157

3

3

CCGCCGCCG

261

3

3

CCGCCGCCG

236

2

3

CGCGCG

396

2

3

CGCGCG

532

3

3

GATGATGAT

1573

2

3

GCGCGC

1631

2

3

GCGCGC

1720

2

3

GCGCGC

198

2

4

GGGGGGGG

1589

2

3

TCTCTC

Table 3 Similarity scores and genetic distance estimated by the Kimura two-parameter model between P. nana (GenBank accession no. FJ214952) and Cyclops kolensis (EF532820) and Cyclopidae sp. (AY210813) according to rDNA locus

Dist.

P. nana 18S

a

Sim. (%)

Cyclopidae sp.

Site

Dist.

Sim. (%)

0.0875 91.0

1824 –

–

ITS1

0.8998 43.4

307 –

–

5.8S

0.0674 93.6

157 –

–

ITS2

0.6047 52.3

231 –

–

28S

0.1347 85.9

3593a 0.1201 87.7

2

3

4

5

6

(kb) 7

8

1 2

1,867 occurrences

5.8S

3 4

28S

5 6 7

3,921 occurrences

IGS

8

(kb)

Search options in the Microsatellite repeats finder web-server are as follows: length of repeated sequence minimum, 2, maximum, 6; minimum number of repeats, 3; minimum length of tandem repeat, 6, allowed percentage of mismatches

Locus Cyclops kolensis

1

18S

Harpacticoida (Tigriopus japonicus)

Position

0

0

Site

3540a

Partial DNA sequence

kolensis and Cyclopidae sp. (Table 3). In this case, we only compared 18S, 28S, 5.8S rDNAs and ITSs, excluding IGS due to incompletion of rDNA and a deficiency of available cyclopoid rDNA sequences. We detected high similarities of the rDNAs between P. nana and C. kolensis (EF532820) at the coding regions (91.0% in 18S, 93.6% in 5.8S, 85.9% in 28S) rather than at non-coding regions (43.4% in ITS1, 52.3% in ITS2). Generally, these kinds of similarities were measured between P. nana rDNA and other cyclopoid copepods with partial DNA sequence data

Fig. 2 Dot matrix comparison of complete rDNA sequence between the cyclopoid P. nana and the harpacticoid T. japonicus (GenBank Accession no. EU054307). The dot-plot was obtained using sliding windows of 60 nucleotides along the compared rDNAs. The dots and lines represent regions of homology between sequence pairs. The open boxes in matrices indicate rDNA coding regions such as 18S, 5.8S, and 28S

matrixes available in public databases (data not shown). For example, the GenBank sequence data included Acanthocyclops viridis Jurine, 1820 (AY626999), Ectocyclops polyspinosus Harada, 1931 (AJ746336), Lamproglena chinensis Yu by Kuang, 1962 (DQ107553), Oithona similis Claus, 1866 (EF460779), and Lamproglena chinensis Yu by Kuang, 1962 (DQ107545). Furthermore, these similarity patterns were generally in accordance with those of the rDNA comparison between the cyclopoid P. nana and the harpacticoid Tigriopus japonicus. In order to determine whether there was any sequence homology between the parallel sequence alignments of copepods, the entire rDNA sequence of P. nana was compared with that of T. japonicus by dot-matrix analysis (Fig. 2). In this comparison, two long homologous regions (18S, 28S rRNA, including 5.8S) were identified, while non-coding regions (e.g., ITS, IGS) were not found to have similar regions, even though these patterns were generally similar in ITS and IGS in other organisms. This indicates that the genetic similarity of IGS in P. nana may be considerably lower than that of other ITS (Table 3). This showed a clear distribution of both variable and conserved positions along the rDNA sequences; the coding regions were conserved, and the other non-coding regions were highly variable.

123

8

Discussion In this study, we first characterized the structure of the complete rDNA from P. nana. The gene arrangement of P. nana was identical to that of the typical eukaryote rDNA in the order (i.e. 18S–5.8S– 28S rDNA, no 5S rDNA). It can be used as a model of complete rDNA to provide molecular comparisons with other copepods, since in copepods mostly partial rDNA sequences are available from GenBank. Copepod sequences deposited in public databases (EMBL/ DDBJ/GenBank) are estimated to be a total of approximately 1,700 strands as of October 2010. However, the rDNA sequences are contributed from only 1,666 strands of rDNA, from Calanoida (total 3,225 strands, 623 rDNA strands), Cyclopoida (794, 272), Harpacticoida (1,307, 149), Monstrilloida (4, 4), Poecilostomatoida (278, 154), and Siphonostomatoida (7,634, 464), respectively. Considering the number of recorded species (11,500 copepods, 1,500 cyclopoids), the available DNA data are still sparse. In addition, most rDNA sequences represented partial sequences of individual rDNA genes, e.g., 18S, ITS5.8S or 28S. There are few DNA sequences covering wide ranges from nuclear 18S to 28S rDNA available from the Copepoda (e.g., Cyclops insignis, C. kolensis, T. californicus). Recently, we sequenced a complete rDNA sequence of T. japonicus (Ki et al., 2009c). Apart from this, there is no entire unit of rDNA sequence available from the Copepoda. Generally, most researchers have focused on 18S rDNA sequencing, and thus at least 270 sequences of cyclopoids were available from GenBank. With sequence comparison, we found that the 18S rDNA gene of P. nana contained 1,808 nucleotides, which was generally similar in size to that of other cyclopoid 18S rDNAs (e.g. Mytilicola intestinalis Steuer, 1902 (Mytilicolidae), AY627005, 1,808 bp, 49.5% GC; Xarifia sp. Humes, 1960 (Xarifiidae), AY627013, 1,805 bp, 49.0% GC; Ectocyclops polyspinosus Harada, 1931 (Cyclopidae), AJ746336, 1,808 bp, 49.6% GC). In addition, searches in the NCBI database showed that the length of cyclopoid 18S rDNAs were around 1,800 bp. On the other hand, GC contents of the 18S rDNA genes were nearly identical among the sequences of cyclopoids, at about 49%. These were generally in accordance with our data for P. nana (Fig. 1A), suggesting that the 18S rDNA would be highly conserved within the

123

Hydrobiologia (2011) 666:3–9

Copepoda including the Cyclopoida. None of the insertion or deletion sites were found within the 18S or 28S coding regions. In addition, the length of 28S rDNA—although incomplete—was nearly identical to those of Cyclops kolensis, C. insignis and Cyclopidae sp. Higher GC contents were measured in the entire 28S rDNA of the Cyclopoida (ca. 54%) than in the 18S rDNA (c. 49%), based on three 28S sequences (P. nana, 54.2% GC; Cyclops kolensis, 54.4% GC; C. insignis, 54.6% GC). The P. nana rDNA IGS was 1,922 nucleotides in length, and its GC content was measured as 48.4% (Fig. 1A). When compared with length variations in rDNA molecules (e.g., 18S, ITS, 28S, IGS), the IGS was considerably different in sequence length (up to 30 kb), even in the same genus, e.g. Tigriopus japonicus (1,417 bp), T. brevicornis (1,928 bp) and T. californicus (3,360 bp). These are mostly caused by the unusual structures of the IGS sequences, i.e., internal subrepeats, microsatellite-like patterns (Burton et al., 2005; Ki et al., 2009b, c). By comparing non-coding rDNA regions, the IGS provides more molecular characteristics (e.g. homopolymer tracts [T, A], microsatellites [AC, AT, GC] subrepeats) than ITS (Fig. 1B; Table 2) (Ki et al. 2009b, c). This finding is supported by a graphical comparison with the dot-plot analysis (Fig. 2), suggesting that rDNA IGS nucleotides have the potential to be used as molecular markers for population history studies (Ki et al., 2009c). There is no question that morphological characteristics are important for discriminating between species, and for confirming new species by morphological description (e.g., Dussart & Defaye, 2006). After centuries of effort, at present the Copepoda are recognized as nine orders: Calanoida, Cyclopoida, Gelyelloida, Harpacticoida, Misophrioida, Monstrilloida, Mormonilloida, Platycopioida, and Siphonostomatoida (Boxshall & Halsey, 2004; Dussart & Defaye, 2006). However, considering the huge inventory of the Copepoda including 200 families, 1,650 genera, and 11,500 species (Humes, 1994), species identities are primarily based on morphological features, particularly on the structure and armature of legs (Kiefer, 1927; Rylov, 1948; Yeatman, 1959; Dussart, 1969; Monchenko, 1974). However, microscopic observations are difficult to achieve in a general sense, and many morphological ambiguities still remain; thus, supplementary molecular data can

Hydrobiologia (2011) 666:3–9

be very useful for discrimination at different taxonomic levels (populations, species, supraspecific taxa). The same holds true particularly for phylogenetic interference studies. This study achieved the first complete sequence of rDNA from the order Cyclopoida, leading to a promising marker for molecular comparisons among the Copepoda. Acknowledgments We thank Mr. Winson K. Chan for his comments on the manuscript. This work was supported by a grant of Korea Research Foundation funded to Huem Gi Park (KRF-2006-C00699). Jang-Seu Ki was a recipient of a postdoctoral fellowship funded by the Korea Research Foundation Grant (KRF-2007-355-C00059).

References Boxshall, G. O. & S. H. Halsey, 2004. An Introduction to Copepod Diversity, Vols. I, II. The Ray Society of London, London: 1–966. Braga, E., R. Zardoya, A. Meyer & J. Yen, 1999. Mitochondrial and nuclear rRNA based copepod phylogeny with emphasis on the Euchaetidae (Calanoida). Marine Biology 133: 79–90. Bucklin, A., B. W. Frost, J. Bradford-Grieve, L. D. Allen & N. J. Copley, 2003. Molecular systematics and phylogenetic assessment of 34 calanoid copepod species of the Calanidae and Clausocalanidae. Marine Biology 142: 333–343. Burton, R. S., E. C. Metz, J. M. Flowers & C. S. Willett, 2005. Unusual structure of ribosomal DNA in the copepod Tigriopus californicus: intergenic spacer sequences lack internal subrepeats. Gene 344: 105–113. Copepod Web Portal (CWP). http://www.luciopesce.net/ copepods/. Drouin, G., J. D. Hofman & W. F. Doolittle, 1987. Unusual ribosomal RNA gene organization in copepods of the genus Calanus. Journal of Molecular Biology 196: 943–946. Dussart, B. H., 1969. Les Cope´podes des Eaux Continentales de Europe Occidentals, Vol. 2. Cyclopoides et Biologie, Boubee´, Paris: 292. Dussart, B. & D. Defaye, 2006. World Directory of Crustacea Copepoda of Inland Waters II—Cyclopiformes. Backhuys Publishers, Leiden: 354 pp. Fiers, F., J. W. Reid, T. M. Iliffe & E. Sua´rez-Morales, 1996. New hypogean cyclopoid copepods (Crustacea) from the Yucatan Peninsula, Mexico. Contributions to Zoology 66: 65–102. Humes, A. G., 1994. How many copepods? Hydrobiologia 292(293): 1–7. Huys, R., J. Llewellyn-Hughes, P. D. Olson & K. Nagasawa, 2006. Small subunit rDNA and Bayesian inference reveal Pectenophilus ornatus (Copepoda incertae sedis) as highly transformed Mytilicolidae, and support assignment

9 of Chondracanthidae and Xarifiidae to Lichomolgoidea (Cyclopoida). Biological journal of the Linnean Society 87: 403–425. Huys, R., J. Llewellyn-Hughes, S. Conroy-Dalton, P. D. Olson, J. N. Spinks & D. A. Johnston, 2007. Extraordinary host switching in siphonostomatoid copepods and the demise of the Monstrilloida: integrating molecular data, ontogeny and antennulary morphology. Molecular Phylogenetics and Evolution 43: 368–378. Ki, J.-S., H. G. Park & J.-S. Lee, 2009a. The complete mitochondrial genome of the cyclopoid copepod Paracyclopina nana: a highly divergent genome with novel gene order and atypical gene numbers. Gene 435: 13–22. Ki, J.-S., I.-C. Kim & J.-S. Lee, 2009b. Comparative analysis of nuclear ribosomal DNA from the moon jelly Aurelia sp. 1 (Cnidaria: Scyphozoa) with characterizations of the 18S, 28S genes and the intergenic spacer (IGS). Hydrobiologia 206: 229–239. Ki, J.-S., K.-W. Lee, H. G. Park, S. Chullasorn, H.-U. Dahms & J.-S. Lee, 2009c. Phylogeography of the copepod Tigriopus japonicus along the Northwest Pacific rim. Journal of Plankton Research 31: 209–221. Kiefer, F., 1927. Versuch eines Systems der Cyclopiden. Zoologischer Anzeiger 73: 302–308. Lee, K.-W., H. G. Park, S. M. Lee & H. K. Kang, 2006. Effects of diets on the growth of the brackish water cyclopoid copepod Paracyclopina nana Smirnov. Aquaculture 256: 346–353. Monchenko, V. I., 1974. The fauna of Ukraine. Naukova dumka (Kiev) 27: 1–449. Pinto, C. S. C., L. P. Souza-Santos & P. J. P. Santos, 2001. Development and population dynamics of Tisbe biminiensis (Copepoda: Harpacticoida) reared on different diets. Aquaculture 198: 253–267. Raue´, H. A., W. Musters, C. A. Rutgers, J. Van’t Riet & R. J. Planta, 1990. rRNA: from structure to function. In Hill, W. E., A. Dahlberg, R. A. Garrett, P. B. Moore, D. Schlessinger & J. R. Warner (eds), The Ribosome, Structure, Function and Evolution. American Society of Microbiology, Washington: 217–235. Reid, J. W., 1994. Latitudinal diversity patterns of continental benthic copepod species assemblages in the Americas. Hydrobiologia 292(293): 341–349. Rylov, V. M., 1948. Fauna USSR. Crustaceana. Cyclopoida of freshwater. Moscow-Leningrad 3: 318. (in Russian). Song, Y., G. T. Wang, W. J. Yao, Q. Gao & P. Nie, 2008. Phylogeny of freshwater parasitic copepods in the Ergasilidae (Copepoda: Poecilostomatoida) based on 18S and 28S rDNA sequences. Parasitology Research 102: 299–306. Sun, B. & J. W. Fleeger, 1995. Sustained mass culture of Amphiascoides atopus, a marine harpacticoid copepod in a recirculating system. Aquaculture 136: 313–321. Yeatman, H. C., 1959. Free-living Copepoda: Cyclopoida. In Edmondson, W. T. (ed.), Ward and Whipple’s Freshwater Biology. Wiley, New York: 795–815.

123