Extraneurologic symptoms as presenting signs of Sanfilippo disease

Case Reports

Extraneurologic Symptoms as Presenting Signs of Sanfilippo Disease Rita Barone, MD*, Agata Fiumara, MD*, Guglielmo R.D. Villani, PhD†, Paola Di Natale, PhD†, Lorenzo Pavone, MD, PhD* Sanfilippo disease, or mucopolysaccharidosis type III, results from the deficiency of lysosomal hydrolases, which impairs heparan sulfate metabolism. Clinically, the disease is characterized by a mild somatic phenotype combined with early severe neurodegenerative illness with prominent behavioral disturbance. We report clinical and molecular findings of a child with Sanfilippo disease type B (␣-N-acetylglucosaminidase deficiency) who presented at age 18 months with marked systemic involvement and normal initial psychomotor development. These findings suggest that atypical mucopolysaccharidosis type III patients may present with early somatic changes preceding the onset of overt neurologic symptoms and ensuring an early diagnosis and possible therapeutic intervention. © 2001 by Elsevier Science Inc. All rights reserved. Barone R, Fiumara A, Villani GRD, Di Natale P, Pavone L. Extraneurologic symptoms as presenting signs of Sanfilippo disease. Pediatr Neurol 2001;25:254-257.

Introduction Sanfilippo disease, or mucopolysaccharidosis type III (MPS III), is an autosomal-recessive disorder that affects glycosaminoglycan metabolism. It results from the deficiency of lysosomal hydrolases leading to heparan sulfate accumulation in tissues and its abnormal excretion in

From the *Division of Pediatric Neurology, Department of Pediatrics, University of Catania, Catania, Italy and the †Department of Biochemistry, University of Naples, “Federico II,” Naples, Italy.

254

PEDIATRIC NEUROLOGY

Vol. 25 No. 3

urine [1]. Based on the enzyme defect, four subtypes (A-D) may be distinguished in which the leading clinical feature is an early and progressive central nervous system involvement. In contrast to other mucopolysaccharidoses, somatic changes are usually lacking in these patients, with the exception of some degree of facial coarsening and hirsutism [1,2]. We report clinical and molecular findings of a child with MPS III B who presented at age 18 months with major somatic changes and normal psychomotor development. Materials and Methods Urine Analyses and Enzymatic Assays Glycosaminoglycans in urine were quantified by using dimethylmethylene blue test and identified as heparan sulfate by thin-layer chromatography. The ␣-N-acetyl-glucosaminidase (NAGLU) activity was measured in serum and fibroblasts by using 4-MU-␣-d-glucosaminide as substrate.

DNA Analysis Genomic DNA isolation from cultured fibroblasts and mutation analysis in the NAGLU gene were performed according to standard procedures. Polymerase chain reaction (PCR) of NAGLU exons was completed with 12 sets of primers, according to Schmidtchen et al. [3] except for the first fragment of exon 1 where the following primers were designed: 5⬘ACCCGCAGGACTGAGACCAT (sense) and 5⬘ACGTGGCAGCCACAGAAGTC (antisense). After amplification, the PCR products were subjected to single strand conformation polymorphism (SSCP) analysis and then directly sequenced by using the Promega fmolTM DNA Sequencing System.

Case Report The patient is male, the fourth child of parents who are first cousins and who come from a small Sicilian town. Family history is unremarkable. He was born at term after a normal pregnancy with a birth weight of 3450 gm. Throughout the first year of life, the child frequently suffered from upper respiratory infections, and at age 4 months he was hospitalized for bilateral inguinal hernia and hydrocele repair. Early psychomotor development was normal. He gained head control at 3 months, sat alone at 7 months, and walked unsupported at 14 months. By the end of the second year, coarse facies and macrocrania were noticed. On physical examination at the age of 18 months, he presented as a well-nourished child with weight 14.5 kg (ninetieth percentile), height 80 cm (twenty-fifth percentile), and head circumference 54 cm (more than ninetieth percentile). He had straw-colored, thick hair and some degree of facial coarsening with frontal bossing, depressed nasal bridge, and plump cheeks. Neither corneal opacities nor macroglossia were present. Heart

Communications should be addressed to: Dr. Rita Barone; Division of Pediatric Neurology; Department of Pediatrics; V.le A. Doria, 6; 95125 Catania, Italy. Received February 14, 2001; accepted April 30, 2001.

© 2001 by Elsevier Science Inc. All rights reserved. PII S0887-8994(01)00305-8 ● 0887-8994/01/$—see front matter

progression in visceral involvement was also noticed because liver and spleen were palpable 9 cm and 5 cm, respectively, below the costal arch. In addition, there were signs of increasing skeletal changes with gait difficulties resulting from aseptic necrosis of the left femoral head, which resolved spontaneously; meanwhile, slight flexion contractures of the elbows became evident. At this time, he was also found to have severe mental retardation (full IQ, 40) with very poor performance in fine-motor abilities and problem solving and marked abnormalities in socialadaptive behavior and sleep disturbances. Longitudinal MRI study at ages 3 and 4.5 years, respectively, revealed atrophic changes with progressive enlargement of the subarachnoid spaces, ventricular widening, and thinning of the corpus callosum. Currently, at the age of 7 years, pertinent neurologic findings include a tip-toe gait and increased muscle tone of the lower limbs with brisk deep tendon reflexes but not ankle clonus. He is only able to pronounce a few simple words, and he exhibits destructive behavior and restlessness; he did not experience seizures. His waking EEG demonstrates a rapid background rhythm with absent response to the activation procedures. He needs constant supervision and sphincter control is absent, and he is able to drink from a cup with assistance. In addition to increased neurologic morbidity, a further enlargement of internal organs was recorded by ultrasound examination, the liver and spleen being palpable 13 cm and 7 cm below the costal arch.

Discussion

Figure 1. Somatic changes as presenting signs of Sanfilippo disease type B in a 18-month-old child with normal psychomotor development: mild facial coarsening, macrocrania, prominent abdomen with marked hepatosplenomegaly, bilateral inguinal hernia, and hydrocele. was normal on both clinical and ultrasound examination. Abdomen was prominent, there were umbilical and inguinal hernias and marked hepatosplenomegaly (liver 4 cm and spleen tip 2 cm below the costal arch) (Fig 1). Neurologic development was normal and he scored 95 on the Termann-Merril developmental scale; he was able to use two-word sentences and had a good attitude to social relationships and an absence of behavioral problems. Skeletal changes included mild thoracolumbar kyphosis and pectus carinatum. There was no joint restriction. Skeletal survey revealed signs of dysostosis multiplex, namely thickening of the calvarium, ovoidal shape of the thoracolumbar vertebral bodies (Fig 2A), and hypoplasia of the acetabular portions of the ilia (Fig 2B). The proximal end of the metacarpal bones was narrowed whereas osseous maturation was retarded with skeletal age corresponding to 12 months (Fig 2C). The diagnosis of mucopolysaccharidosis was suspected and confirmed by the demonstration of elevated excretion of mucopolysaccharides in urine (28 mg/mmol creatinine; normal values, 5 ⫾ 2.6). The presence of heparan sulfate was detected by electrophoresis, and ␣-N-acetylglucosaminidase deficiency was demonstrated in serum and fibroblasts, indicating the diagnosis of Sanfilippo disease type B. DNA analyses revealed he was homozygous for the G292R missense mutation. In view of his young age and preserved mental capabilities, bone marrow transplantation was proposed but was refused by the parents. We followed the patient, and by the end of the second year, neurologic deterioration had been recorded with progressive loss of verbal language and social withdrawal; at the age 3 years, his weight and head circumference were on the ninetieth percentile whereas his height was on the seventy-fifth percentile. Coarse facial changes became more evident, and

Sanfilippo syndrome usually presents in early childhood with a behavioral disturbance in children with a history of delayed development, mainly affecting communicative abilities [2]. The clinical course is then marked by a progressive loss of previously acquired functions and autonomies and in late childhood by increasing motor difficulties because of spasticity and joint stiffness. Patients are usually wheelchair-bound by their mid-teenage years and may demonstrate severe feeding problems because chewing and swallowing are progressively impaired. Somatic abnormalities typical of mucopolysaccharidosis are usually lacking in Sanfilippo disease. Unlike other mucopolysaccharide disorders, physical growth is usually not affected [1]; hernias are uncommon and were present in only five of 62 patients reported by Cleary and Wraith [2]. Coarse hair and face, mild hepatomegaly, and skeletal disease may be a feature only at school age; hence, the diagnosis may be overlooked at the onset [2]. Besides the severe, typical form of Sanfilippo disease type B, which is characterized by progressive neurologic deterioration and death in the second decade, a few patients have been reported with an “attenuated” course and late-onset dementia. These patients usually survive in good health into the fourth decade [4-5]. The patient reported here is unusual because at age 18 months, he presented with an early and marked systemic involvement despite normal neurologic development: he had macrocrania, facial coarsening, marked hepatosplenomegaly, inguinal and umbilical hernias, and signs of skeletal changes. It is not then surprising he was initially suspected of having Hunter syndrome (MPS type II). Later, neurologic deterioration became evident, and increasing signs of cerebral atrophy were recorded by neuroimaging. Interestingly, the rate of internal organ

Barone et al: Atypical Clinical Onset of Sanfilippo Disease 255

Figure 2. Dysostosis multiplex in a patient with MPS III B, who was 18 months of age at the time of diagnosis: (A) Ovoid shape of lumbar vertebral bodies in lateral projection; (B) flaring of the iliac wings and mild hypoplasia of the basilar portions of the ilia; (C) proximal metacarpal pointing and coarse bone trabeculation.

256

PEDIATRIC NEUROLOGY

Vol. 25 No. 3

involvement was also progressive, which is not the case in Sanfilippo patients in whom mild hepatosplenomegaly may be a feature only at the beginning of their first decade. Moreover, the occurrence of aseptic necrosis of the femoral head, as observed in this patient, is unusual in MPS III, whereas Perthes-like lesions have been reported in patients with MPS type IV or VI [1]. Recently the gene coding the NAGLU enzyme has been mapped to chromosome 17q21.1 [6], and molecular analysis has already defined a large number of mutations [3,7-9]. It appears that the clinical variability of Sanfilippo disease type B actually reflects allelic heterogeneity, the R643C allele being associated with the attenuated variant in Dutch patients [10]. The G292R allele, as observed in the present patient, is a missense mutation leading to nonconservative exchange of amino acids in the mature protein. In addition to the present patient the G292R allele has been reported worldwide in severely affected patients both at homozygosity [9] and at heterozygosity with the R565W mutation [10]. Atypical cases of Sanfilippo disease type B have recently been described. One patient presented at age 10 weeks with diarrhea and transient renal tubular dysfunction, followed by hepatosplenomegaly by the age of 3 months. He had nearly absent enzyme residual activity in leukocytes, although the genotype was not reported [11]. In addition, two patients are cited in the literature bearing C277F/M1L and R100H/R100H mutations, respectively, with a very severe course of the disease and onset at birth [9]. Such patients and the present case expand our knowledge of the clinical spectrum associated with Sanfilippo disease type B, and suggest that, in addition to the severe and attenuated phenotypes, atypical cases may exist with

early somatic changes preceding the onset of overt neurologic symptoms, permitting an early diagnosis and possible therapeutic intervention.

References [1] Neufeld EF, Muenzer J. The mucopolysaccharidoses. In: Scriver C, Beaudet A, Sly W, Valle D, eds. The metabolic and molecular bases of inherited disease, 7th ed. New York: McGraw-Hill, 1995:2465-94. [2] Cleary MA, Wraith JE. Management of mucopolysaccharidosis type III. Arch Dis Child 1993;69:403-6. [3] Schmidtchen A, Greenberg D, Zhao H, et al. NAGLU mutations underlying Sanfilippo syndrome type B. Am J Hum Genet 1998;62:64-9. [4] Andria G, Di Natale P, Del Giudice E, Strisciuglio P, Murino P. Sanfilippo B syndrome (MPS III B). mild and severe forms within the same sibship. Clin Genet 1979;15:500-4. [5] van Schrojenstein-de Valk HMJ, van de Kamp JJP. Follow-up on seven adult patients with mild Sanfilippo B-disease. Am J Med Genet 1987;28:125-9. [6] Zhao HG, Bach G, Schmidtchen A, Neufeld EF. The molecular basis of Sanfilippo syndrome type B. Proc Natl Acad Sci USA 1996;93: 6101-5. [7] Zhao HG, Aronovich EL, Whitley CB. Genotype-phenotype correspondence in Sanfilippo syndrome type B. Am J Hum Genet 1998;62:53-63. [8] Beesley CE, Young PE, Vellodi A, Winchester BG. Identification of 12 novel mutations in the ␣-N-acetylglucosaminidase gene in 14 patients with Sanfilippo syndrome type B (mucopolysaccharidosis type IIIB). J Med Genet 1998;35:910-4. [9] Bunge S, Knigge A, Steglich C, et al. Mucopolysaccharidosis type IIIB (Sanfilippo B) identification of 18 novel ␣-N-acetylglucosaminidase gene mutations. J Med Genet 1999;36:28-31. [10] Weber B, Guo XH, Kleijer WJ, et al. Sanfilippo type B syndrome (Mucopolysaccharidosis III B). Allelic heterogeneity corresponds to the wide spectrum of clinical phenotypes. Eur J Hum Mut 1999;7:34-44. [11] Ramaswami U, Van’t Hoff W, Clayton P, Vellodi A. Sanfilippo disease (mucopolysaccharidosis type III) presenting as transient renal tubular dysfunction. J Inher Metab Dis 1996;19:87-8.

Barone et al: Atypical Clinical Onset of Sanfilippo Disease 257