Human Molecular Genetics, 2007, Vol. 16, No. 22 doi:10.1093/hmg/ddm163 Advance Access published on June 27, 2007
2651–2658
Frataxin is essential for extramitochondrial Fe– S cluster proteins in mammalian tissues Alain Martelli1{, Marie Wattenhofer-Donze´1,5{, Ste´phane Schmucker1,4, Samuel Bouvet1, Laurence Reutenauer1,3 and He´le`ne Puccio1,2,3,4,5* 1
IGBMC (Institut de Ge´ne´tique et de Biologie Mole´culaire et Cellulaire), 1 rue Laurent Fries BP 10142, Illkirch F-67400, France, 2Inserm, U596, Illkirch F-67400, France, 3CNRS, UMR7104, Illkirch F-67400, France, 4Universite´ Louis Pasteur, Strasbourg F-67000, France and 5Colle`ge de France, Chaire de Ge´ne´tique Humaine, Illkirch F-67400, France
Received May 28, 2007; Revised and accepted June 21, 2007
INTRODUCTION Friedreich ataxia (FRDA), the most common hereditary ataxia, is a neurodegenerative disease characterized by degeneration of the large sensory neurons and spinocerebellar tracts, cardiomyopathy and an increased incidence of diabetes (1). FRDA is caused by a severe deficiency in frataxin (Fxn) protein, a highly conserved mitochondrial protein, as a result of a GAA repeat expansion in the first intron (2). Although the cellular function of Fxn and its yeast homolog, Yfh1, is still a matter of debate, a role of Fxn as an iron donor in Fe – S cluster (ISC) biogenesis is widely accepted. Indeed, Fxn deficiency both in tissues and cells leads to severe alteration of Fe – S enzymes activities (3 – 5). Reconstitutional and in vivo studies demonstrated that yeast Fxn, Yfh1, is required, although not essential, for ISC biosynthesis (6,7). Yeast Fxn and its bacterial homolog were shown to form a physical complex with the central Fe – S cluster scaffold protein, Isu1/IscU, and the
cysteine desulfurase, Nfs1 (8 – 10). Finally, in vitro works have demonstrated direct iron transfer from Fxn to the human IscU protein (11). Biosynthesis and maturation of Fe– S proteins in eukaryotes is a complex process mediated by a set of highly conserved components that are located in the mitochondria and cytosol (12). In yeast, the de novo synthesis of a nascent ISC is mediated by Isu1/2, the scaffold protein that binds ferrous iron, and Nfs1, the cysteine desulfurase that provides sulfur (5). Yfh1 has been suggested to be the iron donor in this process. In yeast, these three central proteins (Isu1/2, Nfs1 and Yfh1) are found only in mitochondria. Once synthesized in this compartment, ISCs are incorporated into mitochondrial apoproteins by a highly regulated chaperone-mediated process (5,13). For ISC assembly in the cytosol and the nucleus, a component derived from the de novo ISC synthesis is exported by the mitochondrial ABC transporter Atm1p (14). The maturation of cytosolic and nuclear Fe– S proteins therefore requires the close cooperation of the cytosolic assembly
* To whom correspondence should be addressed. Tel: þ33 388653264; Fax: þ33 388653246; Email:
[email protected] {The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.
# The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email:
[email protected]
Downloaded from http://hmg.oxfordjournals.org/ by guest on July 7, 2015
Friedreich ataxia, the most common recessive ataxia, is caused by the deficiency of the mitochondrial protein frataxin (Fxn), an iron chaperone involved in the assembly of Fe – S clusters (ISC). In yeast, mitochondria play a central role for all Fe –S proteins, independently of their subcellular localization. In mammalian cells, this central role of mitochondria remains controversial as an independent cytosolic ISC assembly machinery has been suggested. In the present work, we show that three extramitochondrial Fe – S proteins (xanthine oxidoreductase, glutamine phosphoribosylpyrophosphate amidotransferase and Nth1) are affected in Fxn-deleted mouse tissues. Furthermore, we show that Fxn is strictly localized to the mitochondria, excluding the presence of a cytosolic pool of Fxn in normal adult tissues. Together, these results demonstrate that in mammals, Fxn and mitochondria play a cardinal role in the maturation of extramitochondrial Fe – S proteins. The Fe – S scaffold protein IscU progressively decreases in Fxn-deleted tissues, further contributing to the impairment of Fe – S proteins. These results thus provide new cellular pathways that may contribute to molecular mechanisms of the disease.
2652
Human Molecular Genetics, 2007, Vol. 16, No. 22
RESULTS Frataxin is necessary for cytosolic ISC protein integrity Xanthine oxidoreductase, a cytosolic enzyme containing two [2Fe – 2S] clusters involved in electron transfer, catalyzes the degradation of xanthine and hypoxanthine to yield uric acid (24). XOR activity was initially measured in Fxn-deleted cardiac tissues of the MCK mouse model, and only a late reduction of XOR activity was observed (data not shown). However, as heart samples showed low level of XOR activity (,2 mmol/min per microgram) and no detectable protein (data not shown), the heart tissue is probably not appropriate to assess the effect of Fxn deletion on XOR activity. XOR activity was therefore measured in liver samples deleted for
Figure 1. Xanthine oxidoreductase (XOR) activity in liver samples from the ALB mice. (A) XOR activity, expressed as percentage of the control, was measured in control (n 3) and mutant (n 3) mice. (B) mRNA levels of XOR were determined by quantitative RT–PCR in control (n ¼ 3) and mutant (n ¼ 3) mice; representative western blot analysis with an anti-XOR antibody was carried out on the liver extracts used for the activity measurements. P , 0.005.
Fxn (ALB mutant; Supplementary Material, Fig. S1). A significant and drastic decrease in XOR activity was observed in the liver of mutant mice compared with control, both at 2 and 4 weeks (Fig. 1A). XOR mRNA level was not transcriptionally altered in mutant mice (Fig. 1B). Although a slight decrease in XOR protein level was seen in mutant mice (Fig. 1B), it is not sufficient to account for the strong decrease in activity. Isocitrate dehydrogenase, a mitochondrial Fe –S independent enzyme, showed no significant change in activity (data not shown). Glutamine phosphoribosylpyrophosphate amidotransferase (GPAT), a key enzyme of the purine biosynthesis, is synthesized as an inactive precursor and requires the incorporation of a [4Fe – 4S] cluster for the cleavage of the 11 N-terminal residues propeptide to generate the active enzyme (25). Sitedirected mutagenesis studies of the avian glutamine phosphoribosylpyrophosphate amidotransferase (GPAT) in HeLa cells demonstrated that prevention of the ISC incorporation leads to an inactive unprocessed form that accumulates (25). To assess the maturation of GPAT in Fxn-deleted cardiac tissues, a polyclonal antibody was generated to detect the processed and unprocessed forms of murine GPAT (Fig. 2A, m-GPAT and GPAT –C1F). The signal for the processed form of GPAT was clearly diminished in mutant mice compared with control at 5, 7 and 10 weeks (Fig. 2A). The decrease in the processed GPAT was not due to transcriptional regulation as real-time polymerase chain reaction (RT– PCR) showed no difference at 5 and 7 weeks (Fig. 2B). A significant mRNA decrease was observed in mutant mice at 10 weeks, as previously seen for many other genes (22), which can be attributed
Downloaded from http://hmg.oxfordjournals.org/ by guest on July 7, 2015
machinery, the mitochondrial de novo synthesis machinery and the ISC export machinery. In mammalian cells, the central role of mitochondria in ISC biogenesis for extramitochondrial proteins remains controversial. Indeed, the existence of an independent cytosolic machinery was proposed after the identification of cytosolic isoforms of both IscU (IscU1– p15) and Nfs1, which were shown to promote de novo ISC formation in vitro (15). The possibility that de novo ISC biogenesis also occurs in cytosol is further reinforced by the recent identification of a pool of cytosolic Fxn in cultured cells (16 – 18). However, the recent silencing of the mitochondrial Nfs1 in murine macrophages or HeLa cells revealed that the protein was necessary not only for mitochondrial Fe– S proteins, but also for cytosolic Fe – S proteins such as xanthine oxidoreductase (XOR) or iron regulatory protein-1 (IRP-1) (19,20). Furthermore, deletion of ABCb7, the mammalian Atm1p homolog, in mouse liver leads to a decrease in XOR activity, suggesting that the mitochondrial ISC export machinery is also necessary for the assembly of cytosolic Fe– S protein in mammalian tissues (21). Together, these results suggest that a sulfur moiety necessary for extramitochondrial ISC biosynthesis is most likely provided by the mitochondrial Nfs1 and transported to the cytosol via Abcb7. However, the source of iron for Fe– S protein assembly in the cytosol is unknown. We have previously shown, using conditional mouse model of FRDA, that Fxn deletion in cardiac tissue (MCK model) leads to a drastic impairment of mitochondrial Fe– S enzymes which precedes any detectable pathological and functional changes including the mitochondrial iron accumulation (4). Furthermore, the cytosolic aconitase/IRP-1 balance was affected, suggesting that the mitochondrial ISC machinery is essential for cytosolic Fe– S proteins (22). IRP-1 activation was also observed in HeLa cells that were depleted for Fxn by RNAi (23). However, the intrinsic link between IRP-1 and iron metabolism prevents a clear interpretation. Here, we show that Fxn deletion in mammalian tissues affects three different extramitochondrial enzymes that are dependent on ISC biosynthesis for their activity or maturation, but that are not otherwise linked to iron metabolism. Furthermore, we show the absence of a pool of cytosolic Fxn, providing evidence that the mitochondrial protein is necessary for extramitochondrial ISC biosynthesis, thus further supporting the cardinal role of mammalian mitochondria for ISC proteins.
Human Molecular Genetics, 2007, Vol. 16, No. 22
2653
Figure 2. Glutamine phosphoribosylpyrophosphate amidotransferase (GPAT) maturation in cardiac samples from the MCK mice. (A) Western blot using a GPAT-specific antibody of total heart extracts of control (C) and mutant (M) mice. m-GPAT corresponds to a mature GPAT construct transfected into COS-1 cells, and GPAT– C1F corresponds to a mutated construct for the expression of the precursor. Estimation of mature GPAT level was done using vinculin signal as loading control. (B) mRNA levels of GPAT in control (n ¼ 3) and mutant (n ¼ 3) MCK mice, determined by quantitative RT–PCR. P , 0.01.
Frataxin is necessary for nuclear ISC protein integrity To determine whether the absence of Fxn also leads to a deficit in a nuclear Fe– S protein, we evaluated the activity of Nth1, the mammalian endonuclease III homolog, in cardiac tissues deleted for Fxn. Nth1, a [4Fe –4S] cluster protein, is a glycosylase/AP-lyase involved in the base excision repair of oxidized bases such as thymine glycol (Tg) (26). DNA glycosylase activity was assessed using a synthetic oligonucleotide containing Tg. Nth1 cleaves the strand containing the lesion via a b-elimination mechanism and its activity can be distinguished from Neil1, a second glycosylase/ AP-lyase, which cleaves via a b,d-elimination process (27) (Fig. 3A). A significant decrease in Nth1 activity was observed in mutant mice at 5 weeks, which was even more pronounced at 7 and 10 weeks, reaching 50% of control activity (Fig. 3B). Neil1 activity showed no difference at 5 weeks, but was increased at 7 and 10 weeks in mutant mice, suggesting a compensatory effect triggered by the Nth1 impairment. The change in activity was not due to a transcriptional regulation, as RT – PCR showed no difference between control and mutant mice at 5 and 7 weeks (Fig. 3C). Similar to other transcripts, a significant decrease in both mRNA in mutant mice at 10 weeks was observed. IscU is decreased in Fxn-deleted tissues We previously showed that IscU mRNA level in the MCK mutant mice was only decreased at 10 weeks compared with control (28). However, western blot analysis on total protein extracts shows a progressive decrease in IscU protein in
Fxn-deficient cardiac samples (Fig. 4A). Interestingly, prohibitin (PHB), a mitochondrial protein, was seen increased, in agreement with the mitochondrial proliferation as reported previously in these animals (4). The decrease in IscU was significant at 5 weeks, reaching 50% of the control level by 7 weeks (Fig. 4B). This decrease was also seen when quantified against tubulin (data not shown). In contrast, Nfs1 was not downregulated in Fxn-deficient tissues (Fig. 4A and B). IscU protein level was also decreased at 4 weeks in mutant mice of the ALB model, while it appeared unchanged at 2 weeks (Supplementary Material, Fig. S3). No cytosolic Fxn is detected in adult mouse tissues In addition to its well-established mitochondrial localization (29), Fxn has recently been proposed to be cytosolic (17,18). This possible pool of cytosolic Fxn could participate in the maintenance and/or biosynthesis of extramitochondrial Fe –S proteins. However, fractionation experiments using heart, liver and cerebellum of control adult mice show a strict mitochondrial localization of Fxn (Fig. 5), even though the Fxn antibody is capable of detecting ,1 ng of protein (unpublished data). No signal for Fxn that cannot be accounted by slight mitochondrial contamination was detected in the cytosolic fractions, indicating that a cytosolic pool of Fxn is not present in the mouse tissues used in the present study. Furthermore, no cytosolic isoform of IscU (IscU1– p15) could be detected (Fig. 5), suggesting that the extramitochondrial ISC deficit was directly due to a deficit in the mitochondrial machinery.
DISCUSSION The present report provides the first direct evidence in mammals that Fxn deletion affects the assembly of both cytosolic and nuclear Fe– S proteins, which are not directly involved in iron regulation. Through different conditional mouse models, we have shown that Fxn deletion results in a significant decrease in the specific activities of XOR and Nth1, two enzymes which required proper ISC assembly for their activity, as well as incomplete maturation of GPAT, an
Downloaded from http://hmg.oxfordjournals.org/ by guest on July 7, 2015
to a general transcriptional impairment because of the late disease stage rather than a specific downregulation. Furthermore, a band comigrating with the unprocessed form of GPAT can already be detected in mutant mice at 5 weeks, and clearly increases at 7 and 10 weeks, further suggesting that the maturation step is affected (Fig. 2A). GPAT maturation was also perturbed in liver of the ALB mouse model with a strong decrease in the mature form already observed at 2 weeks (Supplementary Material, Fig. S2).
2654
Human Molecular Genetics, 2007, Vol. 16, No. 22
Figure 4. IscU and Nfs1 protein levels in total heart extracts of MCK mice. (A) Representative western blot with control (C) or mutant (M) mice extracts using anti-IscU, anti-Nfs1 and anti-PHB antibodies. (B) Protein levels were quantified for three mice of each genotype and each age, and expressed as % of control level using the ratio Iscu:PHB or Nfs1:PHB. P , 0.01.
enzyme which requires the insertion of an ISC for its processing. No change was detectable in the activities of proteins that do not contain ISC, further pointing to the specificity of action of Fxn on Fe – S containing enzymes. Oxidative stress is a known factor of instability of some ISC, specifically the ones that are exposed to solvent such as the ISC of aconitases (30) or radical S-adenosyl-L -methionine enzymes (31). However, we have previously shown the absence of detectable protein or lipid oxidative damage in
the heart of the conditional cardiac model (22). Therefore, rather than a destabilization of the specific ISC by reactive oxygen species (ROS), we suggest that the deficiency is related to an ISC biosynthesis deficiency as a direct consequence of the absence of Fxn. Xanthine oxidoreductase activity was drastically decreased in liver deleted for Fxn (Fig. 1A), whereas its basal activity in control heart tissues is too close to the detection limit for reliable measurements. It is worth to note that XOR also
Downloaded from http://hmg.oxfordjournals.org/ by guest on July 7, 2015
Figure 3. Thymine glycol nicking activity of crude nuclear extracts of MCK mice. (A) By-products generated by the nicking activity of Nth1 and Neil1, observed on a 20% denaturing polyacrylamide gel using extracts of 7-week-old mice. The first lane corresponds to the duplex without any addition of extract. 1, 2, 3 and 4 indicate the different products of the reaction as illustrated on the scheme. Nth1 product (2) and Neil1 product (3) were quantified independently to determine the activity of each enzyme. (B) Tg nicking activity, expressed as % of control activity, was determined in control (n ¼ 3) and mutant (n ¼ 3) mice. (C) mRNA levels were determined by quantitative RT– PCR in control (n ¼ 3) and mutant (n ¼ 3) mice. P , 0.05; P , 0.01.
Human Molecular Genetics, 2007, Vol. 16, No. 22
Figure 5. Fractionation of control adult mouse tissues. Mitochondrial (m) and cytosolic (c) fractions were analyzed by western blot: GAPDH and b-tubuline are markers of the cytosolic compartment; PHB and Mn-SOD are markers of the mitochondrial compartment; IscU and frataxin (Fxn).
the notion that, in mammals, mitochondria play a cardinal role in the ISC biogenesis. Our results do not however exclude the existence of a pool of extramitochondrial Fxn and IscU under certain conditions. It is interesting to note that overexpression of cytosolic Fxn was able to rescue FRDA cells against oxidative stress insults (17), and that the cytosolic form of IscU was shown to be required for the regeneration of IRP1 after ISC damage by H2O2 or iron chelator treatment (34). This suggests that a pool of cytosolic Fxn might exist for the regeneration of some ISC damaged by ROS. Interestingly, a progressive downregulation of IscU protein in Fxn-deficient tissues was observed (Fig. 4), similar to what has been reported in FRDA patient fibroblasts and lymphoblasts (35). Although IscU downregulation could by itself be the primary cause of ISC biosynthesis deficiency, the Fe – S protein impairments in heart and liver samples occur prior to IscU downregulation. Indeed, in Fxn-deficient liver, XOR activity is diminished at 2 weeks (Fig. 1A) whereas IscU protein level is normal (Supplementary Material, Fig. S3). Moreover, it has previously been shown by RNAi experiments that a threshold of at least two-fold reduction in IscU must be passed in order to trigger an ISC deficit in HeLa cells (34). We thus hypothesize that partial ISC biogenesis impairment is a primary effect of Fxn deletion, but the consequent progressive IscU decrease further contributes, in a time-dependent manner, to ISC biogenesis deficiency. The mechanism of the posttranscriptional regulation of IscU is unknown, but the fact that Fxn has been shown to form a physical complex with Isu1/IscU (8,9,11) probably plays an essential role. Finally, it will be interesting to determine whether some of the newly identified Fe – S-dependent pathways play a role in the pathogenesis of FRDA, although primarily considered as a mitochondrial disease. In the context of neurodegenerative disorders, the effect on DNA repair pathways is of particular interest. Indeed, in addition to Nth1, two related helicases, XPD and FancJ, involved in the nucleotide excision repair, and Fanconi anemia repair pathways, respectively, have recently been identified as Fe – S proteins (36). This new link between DNA repair, transcription and Fe – S proteins opens some intriguing possibilities for FRDA pathology. It will be interesting to determine whether part of the progressive neurological disease might be accounted by subtle defects in several DNA repair pathways that would lead to accumulation of DNA damages over several years. As DNA repair is one of the other common pathways affected in recessive ataxia (37), this may be the molecular bridge between this heterogeneous group of disorders. In conclusion, we have shown that Fxn is required not only for the biogenesis of mitochondrial containing ISC protein, but also for the biogenesis of cytoplasmic and nuclear ISC proteins. The eventual presence of an independent cytosolic ISC machinery is not sufficient to counteract the mitochondrial dysfunction triggered by the Fxn deletion, a mitochondrial protein with no cytosolic form in the tissues. In the context of FRDA, the identification of ISC-dependent pathways that may be affected by Fxn deficiency opens new venues to understand the pathology of the disease.
Downloaded from http://hmg.oxfordjournals.org/ by guest on July 7, 2015
requires a molybdenum cofactor for its activity. The first step of molybdenum biosynthesis is performed by MOCS1A, an Fe –S enzyme (32) that may also be affected by Fxn deletion. Thus, the drastic decrease in XOR activity could be a cumulative effect of both the reduced molybdenum cofactor biosynthesis as well as its own ISC biosynthesis. Glutamine phosphoribosylpyrophosphate amidotransferase maturation process was clearly affected in both heart and liver, as the level of mature GPAT decreased progressively (Fig. 2A, Supplementary Material, Fig. S2). Interestingly, the precursor accumulation does not completely parallel the decrease in the mature form (Fig. 2A), suggesting that either the unprocessed form gets degraded, or the precursor is less soluble as previously suggested for the avian GPAT (25). The activity of the nuclear DNA repair enzyme Nth1 was significantly affected in heart tissue, and was brought to 50% of residual activity compared with control mice at 7 and 10 weeks (Fig. 3B). Neil1 activity was shown to increase significantly at 7 and 10 weeks (Fig. 3B), although the mRNA level was not modified (Fig. 3C). We exclude the possibility that Neil1 upregulation is due to a direct competition, as the experimental conditions are in excess substrate. It is possible that the posttranscriptional regulation of Neil1 is to compensate the loss of Nth1 activity, although this has not previously been reported in the Nth1 knockout mouse (27). Furthermore, we showed that no Fxn can be detected by western blot analysis in the cytosolic fractions of heart, liver or cerebellum of normal adult mice (Fig. 5), even though the Fxn antibody used has an extreme sensibility. We thus exclude the existence of a cytosolic pool of Fxn that may participate directly in cytosolic ISC biosynthesis machinery in mammalian tissues. These results provide evidence that in addition to the mitochondrial sulfur moiety provided by Nfs1, either a mitochondrial iron moiety provided by Fxn, or a substrate requiring the ISC de novo mitochondrial biosynthesis in which Fxn participates, is required for extramitochondrial ISC protein assembly. Furthermore, we could not detect the previously described cytosolic IscU – p15 (33), suggesting that this isoform is not required for the biosynthesis of extramitochondrial ISC in normal conditions. Our results reinforce
2655
2656
Human Molecular Genetics, 2007, Vol. 16, No. 22
MATERIALS AND METHODS Animals All methods employed in this work are in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publications No. 85-23, revised 1996). Animal care and MCK mutant generation were as previously described (4). A liver-specific Fxn deletion was obtained by crossing DA16 conditional Fxn allele with a transgenic mouse expressing the CRE recombinase under the control of the albumin promoter (38) (unpublished mouse model). Tg nicking activity
Xanthine oxidoreductase activity The method for XOR activity measurement was adapted from Beckman et al. (40). Frozen heart or liver tissues were homogenized in sucrose buffer, pH 7.4 (0.25 M sucrose, 10 mM DTT, 0.2 mM PMSF, 0.1 mM EDTA, 50 mM KH2PO4, pH 7.4) using a polytron (Ultra-Turrax T 25 basic) and
Plasmids Full length GPAT was PCR amplified using EST clone IMAGp998H2314089Q1 (F: 50 -CGGCGGGAATTCCCGAG GCGCCATGGAGC-30 ; R: 50 -CGGCGGCTCGAGCTACCA TTCCAGCTCCACAG-30 ) and cloned into pcDNA3.1 (Invitrogen) to obtain pcDNA3 – GPAT. A truncated GPAT corresponding to the mature form was generated by PCR amplification (F: 50 - CGGCGGGAATTCCCACCATGTGTG GTGTGTTTGGGTGCATC-30 ; R: 50 -CGGCGGCTCGAG CTACCATTCCAGCTCCACAG-30 ) and subcloned into pcDNA3.1 to obtain pcDNA – m-GPAT. pcDNA3 – GPAT – C1F, a noncleavable GPAT precursor bearing a mutation at Cys-12, was generated by directed mutagenesis (F: 50 -GATC CGCGAGGAATTTGGTGTGTTTGGGT-30 ; R: 50 -ACCCAA ACACACCAAATTCCTCGCGGATC-30 ). The mature form of the mouse mitochondrial IscU was amplified by nested PCR (F: 50 -CCGCCGGAATTCCACAAGAAGGTTGTGG-30 ; R: 50 -CCGCCGCTCGAGTCACTGCTTCTCTGGCTC-30 ) using mouse heart cDNA and cloned into pGEX4T1 to give pGEX – IscU. All constructs were verified by DNA sequencing. Recombinant protein expression Recombinant GPAT proteins were generated by transient transfection of COS-1 cells using Fugene Reagent 6 (Roche Diagnostic). After 24 h, cells were lysed and protein extracts were used as size markers. GST – IscU protein was obtained from bacterial expression of pGEX –IscU in XL1 Blue cells and purified on glutathione sepharose 4B column according to the manufacturer’s recommendations (Amersham Biosciences).
Downloaded from http://hmg.oxfordjournals.org/ by guest on July 7, 2015
Thymine glycol nicking activity was measured as described previously (39), with minor adaptation. Frozen hearts were homogenized in buffer A (10 mM HEPES – KOH, pH 7.7, 0.5 mM MgCl2, 10 mM KCl, 1 mM DTT) using a polytron (Ultra-Turrax T 25 basic) and then centrifuged at 2000g, 48C for 10 min. The pellet was resuspended in buffer B (20 mM HEPES– KOH, pH 7.7, 0.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 25% glycerol, 1 mM DTT) and gently stirred at 48C for 15– 20 min to allow an efficient nuclear lysis. The suspension was centrifuged at 14 000g, 48C for 10 min and the supernatant (nuclear extract) was dialyzed against buffer C (40 mM HEPES – KOH, pH 7.7, 50 mM KCl, 2 mM DTT) during 3 h. After determining the protein concentration by Bradford assay, nuclear extracts were immediately used for Tg nicking activity using a 34-mer synthetic oligonucleotide containing the oxidized base Tg: 50 -GGC TTC ATC GTT GTC (Tg)CA GAC CTG GTG GAT ACC-30 (kind gift from Dr Gasparutto, Grenoble). Labeled oligonucleotide containing Tg was annealed with two equivalents of its non-oxidized complementary strand. Two microliters of crude nuclear extract were incubated with 0.1 pmol of labeled DNA duplex in buffer D (40 mM HEPES –KOH, pH 7.7, 100 mM KCl, 0.5 mM EDTA, 0.5 mM DTT, 0.2 mg/ml bovine serum albumin) for 1 h at 378C. The reaction was stopped by the addition of sodium dodecyl sulfate (SDS; 0.5%) and proteinase K (0.8 mg/ml) and further incubated for 15 min at 558C. After phenol –chloroform extraction, one volume of loading buffer (formamide 98%, 10 mM EDTA, xylene cyanol 0.01% and bromophenol blue 0.01%) was added to the samples. Samples were separated on a 20% acrylamide/ bisacrylamide (19:1) denaturing gel in TBE buffer. Gels were exposed to a phosphoscreen that was subsequently analyzed using a Typhoon apparatus (GE Healthcare, UK). Bands corresponding to cleaved and uncleaved products were quantified using ImageQuant TL software (GE Healthcare, UK). Reported activities correspond to the percentage of Tg cleavage per microgram total protein per hour.
centrifuged at 15 000g, 48C to pellet tissues debris. Clear supernatants, containing total protein extract, were used for the measurements of XOR activity on a PTI (Photon Technology International TimeMaster; Bioritech) spectrofluorometer (excitation, 345 nm; emission, 390 nm) as followed: homogenates were diluted in 1 ml of phosphate buffer, pH 7.4 (50 mM KH2PO4, pH 7.4, 0.1 mM EDTA) and warmed to 378C in the cuvette for further baseline drift measurement. Twenty microliter of 1 mM pterin (Fluka) was then added to measure the activity of xanthine oxidase. Once a linear rate was obtained, 20 ml of 1 mM methylene blue (Riedel-de Hae¨n) was added as an electron acceptor to measure the combined xanthine oxidase and xanthine dehydrogenase activities. The reaction was then inhibited by the addition of 20 ml of 3.5 mM allopurinol (Sigma). A 0.5 mM final concentration of isoxanthopterin (Fluka) was added and the immediate fluorescence increase was used as an internal standard for activity calculation. Activities were calculated as follows: A ¼ {DF [I]/FI} 0.001 Vc/(Vs P), where A is the enzyme activity (in mmol/min/mg total protein); DF, the change in fluorescence per minute; [I], the concentration of isoxanthopterin added; FI, the immediate increase in the fluorescence produced by the addition of isoxanthopterin; Vc, the cuvette volume (in mL); Vs, the volume of sample added to the cuvette (in mL); and P, the protein concentration of the sample (in mg).
Human Molecular Genetics, 2007, Vol. 16, No. 22
Antibodies A polyclonal antibody against mouse GPAT (R2374) was raised against peptide PH228 (CLTGQYPVELEW). Affinity purification was performed using a peptide-coupled sulfo-link gel column according to the manufacturer’s protocol (Pierce). A polyclonal antibody against mouse IscU (R2386) was raised against peptide PH234 (CADYKLKQESKKEEPEKQ). Affinity purification was performed using a GST – IscU sulfo-link gel coupled column (Pierce).
Protein electrophoresis and western blots
Subcellular fractionation The method was adapted from Gray and Whittaker (41). Briefly, mouse tissues were homogenized in sucrose – HEPES buffer (0.32 M sucrose, 4 mM HEPES, pH 7.4) in the presence of a protease inhibitor cocktail using a glass dounce. Homogenates were filtered on Sefar Nitrex 03-70/33 (Merck) and centrifuged at 1000g, 48C for 10 min. The supernatant was centrifuged at 10 000g, 48C for 10 min. The pellet, corresponding to the mitochondrial fraction, was washed once with the sucrose – HEPES buffer. The supernatant was further centrifuged at 100 000g, 48C for 60 min to get the soluble cytosolic fraction. mRNA level determination Total RNA from tissues was obtained using Trizol according to the manufacturer’s protocol (Invitrogen). cDNA was generated using the Superscript II kit (Invitrogen) according to the manufacturer’s protocol with oligo dT. Quantitative RT –PCR was achieved using LightCycler (Roche Biosciences) and the following primers: Nth1, forward 50 -CAAGATGGCACACT TGGCTATG-30 , reverse 50 -GTCCGTTGACCTCACTCCAC AG-30 ; Neil1, forward 50 -CCTGCTGGAACTGTGTCAC TTG-30 , reverse 50 -CAGCTGTGTCTCCTGTGACTTC-30 ; XOR, forward 50 -CCATTGAGTTCAGAGTATCCCTG-30 , reverse 50 -TTCTGGTGTTCCAGTGGCACACAG-30 ; GPAT, reverse forward 50 -ATCCGTGCTTCATGGGAATA-30 , 0 5 -TTCTGGTGTTCCAGTGGCACACAG-30 ; hypoxanthineguanine phosphoribosyltransferase (HPRT), forward 50 -GTA
ATGATCAGTCAACGGGGGAC-30 , reverse 50 -CCAGCAA GCTTGCAACCTTAACCA-30 . HPRT was used as control.
SUPPLEMENTARY MATERIAL Supplementary Material is available at HMG Online.
ACKNOWLEDGEMENTS We thank Michel Koenig for fruitful discussions, Didier Gasparutto (CEA-Grenoble) for the kind gift of synthetic oligonucleotides, and Ce´cile Bouton for the kind gift of the Nfs1 antibody. We also thank Franc¸oise Hoegy and Isabelle Schalk (ESBS, Illkirch) for help in the fluorometric measurements. This work was funded by the French National Agency for Research (ANR-05-MRAR-013-01), the French Ministry for Research (ACI-JC5375) and the French Medical Research Foundation ‘Equipe FRM 2005’ (DEQ2005-1205774). M.W. is ATER Colle`ge de France. Conflict of Interest statement: None declared.
REFERENCES 1. Harding, A.E. (1981) Friedreich’s ataxia: a clinical and genetic study of 90 families with an analysis of early diagnostic criteria and intrafamilial clustering of clinical features. Brain, 104, 589– 620. 2. Campuzano, V., Montermini, L., Molto, M.D., Pianese, L., Cossee, M., Cavalcanti, F., Monros, E., Rodius, F., Duclos, F., Monticelli, A. et al. (1996) Friedreich’s ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science, 271, 1423–1427. 3. Rotig, A., de Lonlay, P., Chretien, D., Foury, F., Koenig, M., Sidi, D., Munnich, A. and Rustin, P. (1997) Aconitase and mitochondrial iron-sulphur protein deficiency in Friedreich ataxia. Nat. Genet., 17, 215–217. 4. Puccio, H., Simon, D., Cossee, M., Criqui-Filipe, P., Tiziano, F., Melki, J., Hindelang, C., Matyas, R., Rustin, P. and Koenig, M. (2001) Mouse models for Friedreich ataxia exhibit cardiomyopathy, sensory nerve defect and Fe –S enzyme deficiency followed by intramitochondrial iron deposits. Nat. Genet., 27, 181– 186. 5. Muhlenhoff, U., Gerber, J., Richhardt, N. and Lill, R. (2003) Components involved in assembly and dislocation of iron-sulfur clusters on the scaffold protein Isu1p. Embo J., 22, 4815–4825. 6. Duby, G., Foury, F., Ramazzotti, A., Herrmann, J. and Lutz, T. (2002) A non-essential function for yeast frataxin in iron-sulfur cluster assembly. Hum. Mol. Genet., 11, 2635–2643. 7. Muhlenhoff, U., Richhardt, N., Ristow, M., Kispal, G. and Lill, R. (2002) The yeast frataxin homolog Yfh1p plays a specific role in the maturation of cellular Fe/S proteins. Hum. Mol. Genet., 11, 2025–2036. 8. Gerber, J., Muhlenhoff, U. and Lill, R. (2003) An interaction between frataxin and Isu1/Nfs1 that is crucial for Fe/S cluster synthesis on Isu1. EMBO Rep., 4, 906 –911. 9. Ramazzotti, A., Vanmansart, V. and Foury, F. (2004) Mitochondrial functional interactions between frataxin and Isu1p, the iron –sulfur cluster scaffold protein, in Saccharomyces cerevisiae. FEBS Lett, 557, 215–220. 10. Layer, G., Ollagnier-de Choudens, S., Sanakis, Y. and Fontecave, M. (2006) Iron–sulfur cluster biosynthesis: characterization of Escherichia coli CYaY as an iron donor for the assembly of [2Fe –2S] clusters in the scaffold IscU. J. Biol. Chem., 281, 16256– 16263. 11. Yoon, T. and Cowan, J.A. (2003) Iron– sulfur cluster biosynthesis. Characterization of frataxin as an iron donor for assembly of [2Fe–2S] clusters in ISU-type proteins. J. Am. Chem. Soc., 125, 6078– 6084. 12. Lill, R., Dutkiewicz, R., Elsasser, H.P., Hausmann, A., Netz, D.J., Pierik, A.J., Stehling, O., Urzica, E. and Muhlenhoff, U. (2006) Mechanisms of iron-sulfur protein maturation in mitochondria, cytosol and nucleus of eukaryotes. Biochim. Biophys. Acta, 1763, 652–667.
Downloaded from http://hmg.oxfordjournals.org/ by guest on July 7, 2015
Total extracts were obtained by homogenizing frozen tissues in 0.15 M Tris– HCl, pH 6.8, 25% glycerin, and 5% SDS as described previously (4). Two different protein electrophoresis systems were used [SDS – Tris/glycine –polyacrylamide gel electrophoresis (PAGE) and SDS – Tricine – PAGE] and western blot were carried out as previously described (4). Antibodies were diluted as follows: anti-Fxn (R1270) and antivinculine (VIN-11-5, Sigma) at 1/1000; anti-GPAT (R2374) and anti-IscU (R2386) at 1/2000; anti-Nfs1, anti-XOR (Ab6194, Abcam), anti-b tubuline (MAB3408, Chemicon International), anti-PHB (RB-292-P, Neomarkers Inc.) and anti-Mn SOD (SOD-110, StressGen) at 1/5000; antiglyceraldehyde 3-phosphate dehydrogenase (GAPDH; MAB374, Chemicon International) at 1/50 000. HRP-coupled secondary antibodies were diluted at 1/5000.
2657
2658
Human Molecular Genetics, 2007, Vol. 16, No. 22
28. Schoenfeld, R.A., Napoli, E., Wong, A., Zhan, S., Reutenauer, L., Morin, D., Buckpitt, A.R., Taroni, F., Lonnerdal, B., Ristow, M. et al. (2005) Frataxin deficiency alters heme pathway transcripts and decreases mitochondrial heme metabolites in mammalian cells. Hum. Mol. Genet., 14, 3787–3799. 29. Campuzano, V., Montermini, L., Lutz, Y., Cova, L., Hindelang, C., Jiralerspong, S., Trottier, Y., Kish, S.J., Faucheux, B., Trouillas, P. et al. (1997) Frataxin is reduced in Friedreich ataxia patients and is associated with mitochondrial membranes. Hum. Mol. Genet., 6, 1771–1780. 30. Bulteau, A.L., Ikeda-Saito, M. and Szweda, L.I. (2003) Redox-dependent modulation of aconitase activity in intact mitochondria. Biochemistry, 42, 14846–14855. 31. Layer, G., Heinz, D.W., Jahn, D. and Schubert, W.D. (2004) Structure and function of radical SAM enzymes. Curr. Opin. Chem. Biol., 8, 468–476. 32. Hanzelmann, P., Hernandez, H.L., Menzel, C., Garcia-Serres, R., Huynh, B.H., Johnson, M.K., Mendel, R.R. and Schindelin, H. (2004) Characterization of MOCS1A, an oxygen-sensitive iron-sulfur protein involved in human molybdenum cofactor biosynthesis. J. Biol. Chem., 279, 34721–34732. 33. Tong, W.H. and Rouault, T. (2000) Distinct iron-sulfur cluster assembly complexes exist in the cytosol and mitochondria of human cells. EMBO J., 19, 5692–5700. 34. Tong, W.H. and Rouault, T.A. (2006) Functions of mitochondrial ISCU and cytosolic ISCU in mammalian iron –sulfur cluster biogenesis and iron homeostasis. Cell. Metab., 3, 199–210. 35. Tan, G., Napoli, E., Taroni, F. and Cortopassi, G. (2003) Decreased expression of genes involved in sulfur amino acid metabolism in frataxin-deficient cells. Hum. Mol. Genet., 12, 1699– 1711. 36. Rudolf, J., Makrantoni, V., Ingledew, W.J., Stark, M.J. and White, M.F. (2006) The DNA repair helicases XPD and FancJ have essential iron– sulfur domains. Mol. Cell. Biol., 23, 801–808. 37. Paulson, H.L. and Miller, V.M. (2005) Breaks in coordination: DNA repair in inherited ataxia. Neuron, 46, 845–848. 38. Postic, C., Shiota, M., Niswender, K.D., Jetton, T.L., Chen, Y., Moates, J.M., Shelton, K.D., Lindner, J., Cherrington, A.D. and Magnuson, M.A. (1999) Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. J. Biol. Chem., 274, 305–315. 39. Takao, M., Kanno, S., Shiromoto, T., Hasegawa, R., Ide, H., Ikeda, S., Sarker, A.H., Seki, S., Xing, J.Z., Le, X.C. et al. (2002) Novel nuclear and mitochondrial glycosylases revealed by disruption of the mouse Nth1 gene encoding an endonuclease III homolog for repair of thymine glycols. EMBO J., 21, 3486–3493. 40. Beckman, J.S., Parks, D.A., Pearson, J.D., Marshall, P.A. and Freeman, B.A. (1989) A sensitive fluorometric assay for measuring xanthine dehydrogenase and oxidase in tissues. Free Radic. Biol. Med., 6, 607–615. 41. Gray, E.G. and Whittaker, V.P. (1962) The isolation of nerve endings from brain: an electron-microscopic study of cell fragments derived by homogenization and centrifugation. J. Anat., 96, 79 –88.
Downloaded from http://hmg.oxfordjournals.org/ by guest on July 7, 2015
13. Lutz, T., Westermann, B., Neupert, W. and Herrmann, J.M. (2001) The mitochondrial proteins Ssq1 and Jac1 are required for the assembly of iron sulfur clusters in mitochondria. J Mol Biol, 307, 815 –825. 14. Kispal, G., Csere, P., Prohl, C. and Lill, R. (1999) The mitochondrial proteins Atm1p and Nfs1p are essential for biogenesis of cytosolic Fe/S proteins. EMBO J., 18, 3981–3989. 15. Li, K., Tong, W.H., Hughes, R.M. and Rouault, T.A. (2006) Roles of the mammalian cytosolic cysteine desulfurase, ISCS, and scaffold protein, ISCU, in iron– sulfur cluster assembly. J. Biol. Chem., 281, 12344–12351. 16. Acquaviva, F., De Biase, I., Nezi, L., Ruggiero, G., Tatangelo, F., Pisano, C., Monticelli, A., Garbi, C., Acquaviva, A.M. and Cocozza, S. (2005) Extra-mitochondrial localisation of frataxin and its association with IscU1 during enterocyte-like differentiation of the human colon adenocarcinoma cell line Caco-2. J. Cell. Sci., 118, 3917–3924. 17. Condo, I., Ventura, N., Malisan, F., Tomassini, B. and Testi, R. (2006) A pool of extramitochondrial frataxin that promotes cell survival. J. Biol. Chem., 281, 16750–16756. 18. Lu, C. and Cortopassi, G. (2007) Frataxin knockdown causes loss of cytoplasmic iron –sulfur cluster functions, redox alterations and induction of heme transcripts. Arch. Biochem. Biophys., 457, 111 –122. 19. Fosset, C., Chauveau, M.J., Guillon, B., Canal, F., Drapier, J.C. and Bouton, C. (2006) RNA silencing of mitochondrial m-Nfs1 reduces Fe–S enzyme activity both in mitochondria and cytosol of mammalian cells. J. Biol. Chem., 281, 25398–25406. 20. Biederbick, A., Stehling, O., Rosser, R., Niggemeyer, B., Nakai, Y., Elsasser, H.P. and Lill, R. (2006) Role of human mitochondrial Nfs1 in cytosolic iron –sulfur protein biogenesis and iron regulation. Mol. Cell. Biol., 26, 5675–5687. 21. Pondarre, C., Antiochos, B.B., Campagna, D.R., Clarke, S.L., Greer, E.L., Deck, K.M., McDonald, A., Han, A.P., Medlock, A., Kutok, J.L. et al. (2006) The mitochondrial ATP-binding cassette transporter Abcb7 is essential in mice and participates in cytosolic iron–sulfur cluster biogenesis. Hum. Mol. Genet., 15, 953–964. 22. Seznec, H., Simon, D., Bouton, C., Reutenauer, L., Hertzog, A., Golik, P., Procaccio, V., Patel, M., Drapier, J.C., Koenig, M. et al. (2005) Friedreich ataxia: the oxidative stress paradox. Hum. Mol. Genet., 14, 463 –474. 23. Stehling, O., Elsasser, H.P., Bruckel, B., Muhlenhoff, U. and Lill, R. (2004) Iron-sulfur protein maturation in human cells: evidence for a function of frataxin. Hum. Mol. Genet., 13, 3007–3015. 24. Harrison, R. (2002) Structure and function of xanthine oxidoreductase: where are we now? Free Radic. Biol. Med., 33, 774 –797. 25. Zhou, G., Broyles, S.S., Dixon, J.E. and Zalkin, H. (1992) Avian glutamine phosphoribosylpyrophosphate amidotransferase propeptide processing and activity are dependent upon essential cysteine residues. J. Biol. Chem., 267, 7936–7942. 26. Ide, H. and Kotera, M. (2004) Human DNA glycosylases involved in the repair of oxidatively damaged DNA. Biol. Pharm. Bull., 27, 480 –485. 27. Takao, M., Kanno, S., Kobayashi, K., Zhang, Q.M., Yonei, S., van der Horst, G.T. and Yasui, A. (2002) A back-up glycosylase in Nth1 knock-out mice is a functional Nei (endonuclease VIII) homologue. J. Biol. Chem., 277, 42205–42213.
