H441 Cells, a Bronchiolar Epithelial Cell with Glucocorticoid-Regulated Na+ Transport, Express Classic Enac Channels

AJP-Lung Articles in PresS. Published on October 5, 2001 as DOI 10.1152/ajplung.00085.2001

Glucocorticoid-stimulated Na+ transport in human lung epithelia is associated with regulated ENaC and sgk1 expression. H441 CELLS, A BRONCHIOLAR EPITHELIAL CELL WITH GLUCOCORTICOID-REGULATED NA+ TRANSPORT, EXPRESS CLASSIC ENAC CHANNELS.

Omar A. Itani*, Scott D. Auerbach*, Russell F. Husted*, Kenneth A. Volk*, Shana Ageloff#, Mark A. Knepper#, John B. Stokes*†, and Christie P. Thomas*†‡

Department of Internal Medicine*, University of Iowa College of Medicine †

and the Veterans Affairs Medical Center , Iowa City, IA and Laboratory of Kidney and Electrolyte Metabolism, National Heart, Lung and Blood Institute, #

National Institutes of Health , Bethesda, Maryland

Running title: ENaC, sgk1 and Na+ channels in lung epithelial cells.

‡

Address for correspondence:

Christie P Thomas MD Department of Internal Medicine, E300 GH, University of Iowa, 200 Hawkins Drive, Iowa City, IA 52242 Tel: 319-356-4216 Fax: 319-356-2999 e-mail: [email protected]

1

Copyright 2001 by the American Physiological Society.

ABSTRACT. When grown on permeable supports, H441, a human bronchiolar epithelial cell line develops an amiloride-sensitive Na+ transport pathway that is glucocorticoidregulated (JBC 274: 12431-12437).

To understand the molecular basis for the

electrogenic Na+ transport, we examined the effect of dexamethasone on α, β and γENaC and sgk1 mRNA expression and determined the biophysical properties of Na+ channels in these lung epithelial cells. Dexamethasone stimulated the expression of α, β, γENaC and sgk1 mRNA with the first effect seen by 1 hr. These effects were abolished by actinomycin D, but not by cycloheximide, indicating a direct stimulatory effect on ENaC and sgk1 mRNA synthesis. The glucocorticoid effect on transcription of αENaC mRNA was accompanied by a significant increase in αENaC protein levels. Glucocorticoids also stimulated α,β and γENaC and sgk1 mRNA expression in A549 cells, a human alveolar type II cell line.

To determine the biophysical

properties of the Na+ channel, single channel currents were recorded from cellattached H441 membrane patches. A Na+ selective channel with slow kinetics and a slope conductance of 10.8 pS was noted, properties similar to αβγENaC expressed in X. Laevis oocytes. These experiments indicate that amiloride-sensitive Na+ transport is probably mediated through classic ENaC channels in human lung epithelia and that glucocorticoid-regulated Na+ transport is accompanied by increased transcription of each of the component subunits and sgk1.

Key words: epithelial Na+ channel, amiloride, short circuit current, patch clamp, cyclic AMP, corticosteroids, airway epithelia, alveolar type II cells.

2

INTRODUCTION. The developing alveoli in the fetal lung are filled with liquid that arises, in part, from fluid secreted into the alveolar lumen coupled to Cl- secretion (49). At the time of birth net fluid secretion ceases and absorption occurs in order to establish pulmonary gas exchange.

It is now clear that this transition from

secretion to absorption coincides with the loss of Cl- secretion and the active reabsorption of Na+ across the luminal surface of alveolar and bronchiolar epithelia (7, 36). The leading molecular candidate to effect Na+ absorption by the lung is the epithelial Na+ channel (ENaC).

Three subunits termed α, β and γ have been

identified by several laboratories [reviewed in (3, 19)]. When expressed together, these subunits reconstitute an amiloride-sensitive Na+ selective ion channel with properties similar to that recorded in various epithelia including fetal distal lung epithelial cells (FDLE) and alveolar type II cells (23, 56). In the developing rat fetal lung α, β and γ ENaC mRNA are expressed around the time of birth, coinciding with the phenotype switch that occurs to reabsorb liquid from the alveolar lumen (52, 63). There is considerable evidence that ENaC expression and function can be regulated by glucocorticoids. Glucocorticoids induce amiloride-sensitive Na+ transport in the immature fetal lung and increase Na+ and fluid transport in the adult lung (4, 17, 60).

Whether given during the antenatal period to the

developing fetus or during adult life, exogenous glucocorticoids increase αENaC mRNA dramatically (48, 52).

In addition, the increase in lung ENaC mRNA

3

abundance in the immediate perinatal period correlates closely with the increase in circulating endogenous glucocorticoids (51, 63). This effect of glucocorticoid hormones on ENaC expression may be a previously unrecognized mechanism of action of glucocorticoid therapy on lung maturation when given to the preterm infant (37). The serum and glucocorticoid regulated serine/threonine protein kinase, sgk, was first described as an immediate early response gene in rat mammary epithelia and rat-2 fibroblasts (64). The sgk transcript (now renamed sgk1), is rapidly induced in vivo by glucocorticoids or aldosterone in a variety of rat tissues, and similar responses are seen in epithelial cells derived from the rabbit, amphibian and canine kidney collecting duct (9, 13, 33, 34, 46).

The stimulated

kinase may have a direct impact on corticosteroid-regulated epithelial Na + transport as co-expression of sgk1 with α,β,γ ENaC mRNA in Xenopus oocytes significantly enhances Na+ current (13, 34). Alveolar type II cells and airway epithelial cells are thought to be the primary sites for reabsorption of Na+ in the lung. These cells express all ENaC mRNAs but the biophysical profile of Na+ channels expressed in these cells may be different from that of the kidney collecting duct (31). Since channels made of αENaC alone and α,β or α,γ subunits have properties that are different from the hetero-multimer (32), it has been proposed that the alveolar and airway Na + channel may have a different stoichiometry of ENaC subunits. Alternatively Na + transport in the alveolar and airway epithelia may occur, at least partly, via nonENaC Na+ channels.

4

In this paper we describe human airway and alveolar cell lines with glucocorticoid-regulated expression of α,β,γENaC and sgk1 mRNA and amiloridesensitive Na+ transport. We demonstrate that one of these cell lines shows 3′ 5′cyclic adenosine monophosphate- (cAMP) stimulated Na+ transport and has Na+ channels with biophysical properties predicted for an α,β,γ ENaC hetero-multimer. We also determine that the glucocorticoid effects on all ENaC subunits and sgk1 are likely to be transcriptional.

5

METHODS. Materials. Dexamethasone, amiloride, cycloheximide, forskolin and 3-isobutyl-1-methylxanthine (IBMX) were purchased from Sigma Biochemicals (St. Louis, MO). Actinomycin D was obtained from Roche Molecular Biochemicals (Indianapolis, IN), benzamil from Research Biochemical International (Natick, MA) and [α-32P]UTP from NEN Life Science Products (Boston, MA).

Culture media were obtained from Life

Technologies (Gaithersburg, MD) and DNA sequencing and synthesis was a service provided by the University of Iowa DNA core facility.

Tissue culture and RNA analysis. H441 cells were cultured in RPMI 1640 as described previously (53). A549 cells (American Tissue Culture Collection, Manassas, VA) and HEK293 cells (Gene Transfer Vector Core, University of Iowa) were cultured respectively in Minimum Essential Medium and Ham's F12 supplemented with 10% fetal bovine serum. To examine the effects of dexamethasone on gene expression, cell cultures were switched to serum-free medium and then treated with various concentrations of steroid or vehicle for 24 hr in the presence or absence of actinomycin D or cycloheximide. To determine the time course for gene expression on permeable supports, H441 cells were grown on 30 mm Millicell PCF filters (Millipore, Bedford, MA), switched to serum-free steroid-free media for 24 hr and then exposed to 100 nM dexamethasone for various times. Total RNA was extracted from H441, A549 and HEK293 cells as previously described (33).

6

Measurement of short-circuit current. To measure short-circuit current, H441 cells were grown for 4-7 days in RPMI1640 with 6% serum and 100 nM dexamethasone on 12-mm Millicell PCF filters To determine the effect of glucocorticoids and cAMP on epithelial Na+

(44).

transport, cells on filters were switched to steroid-free media for 24 hr, and then exposed to 100 nM dexamethasone or to 10 µM forskolin and 100 µM IBMX for various times. Short-circuit currents (Isc) and transepithelial resistance (RT) were measured at various time points in an Ussing chamber with or without 10 µM apical benzamil and the cells returned to normal culture conditions between measurements.

Cloning of hsgk1,2,3. Total RNA prepared from H441 cells that had been treated with 100 nM dexamethasone for 24 hr was reverse transcribed using oligo-dT and M-MLV reverse transcriptase as previously described (33). Briefly, 2 µl of first strand cDNA was subjected to PCR amplification for 25 cycles using gene specific primers and Taq DNA polymerase (Promega, Madison, WI) to obtain hsgk1,2 and 3 cDNA fragments. To

clone

hsgk1,

the

primers

5’

CTCCTGCAGAAGGACAGGA

and

5’-

GGACAGGCTCTT CGGTAAACT were used with an anneal step at 55oC; to clone hsgk2,

the

primers

5’-TGTATCTCTCTGCCCTGCCAACC

and

5’-

CATTTCCCAGCCTCCATTCC were used with an anneal step at 55oC; and to clone hsgk3,

the

primers

5’

CCACTTACAAAGAGAACGGTCC

CATACAGAACAGCCCCAAGG used with an anneal step at 62oC.

and

5’-

Amplified

7

fragments were cloned into pCRXLTOPO (Invitrogen, Carlsbad, CA) and individual clones sequenced.

Ribonuclease protection assay (RPA) for ENaC and sgk. Steady state levels of α,β and γ ENaC mRNA were measured by RPA in H441 and A549 cells grown either as monolayers on 75 cm2 polystyrene flasks (Corning, NY) or on 30 mm Millicell PCF filters. To measure α,β and γ ENaC mRNA 10 µg RNA samples were hybridized with individual radiolabeled antisense cRNA probes along with 18S rRNA as control. Templates for synthesis of hαENaC-1 and hγENaC cRNA probes have been previously described, as has solution hybridization, nuclease digestion and identification of nuclease protected products by PAGE (44, 54). To measure hβENaC mRNA levels, one of two templates were used. In some experiments, a 537 bp hβENaC fragment in pCR3.1 (gift from Paul McCray, University of Iowa) was used to create a linearized template, and a 182 bp cRNA probe then synthesized from the T7 promoter to protect a 102 bp βENaC cRNA fragment from ribonuclease digestion.

In later experiments, a human βENaC

fragment in pCRII (Invitrogen) was used to create a linearized template, and a 358 bp cRNA probe synthesized from the SP6 promoter to protect a 177 bp cRNA fragment from ribonuclease digestion. For hsgk2 and 3, cDNAs cloned into pCRXLTOPO were linearized with BamH I and antisense cRNA probes synthesized from the T7 promoter. For hsgk1, the full length cDNA was amplified from H441 RNA using 5’-ACGTCTTTCTGTCTCCCCG and 5’- GGCTCCACCAAAAGGCTAAC and a 181 bp Apa1-Dra1 fragment was

8

subcloned into pCDNA3 (Invitrogen), linearized and a cRNA probe synthesized from the T7 promoter. H441 cell RNA was hybridized with hsgk cRNA and 18S rRNA probes and mRNA expression levels determined by RPA as described for α,β and γENaC.

Immunoblotting of αENaC. H441 cells exposed to 100 nM dexamethasone or vehicle for 24 hr were directly lysed in 1 x Laemmli buffer (1.5% SDS, 6% glycerol, 50 mM Tris, pH 6.8) and protein concentration determined by spectrofluorometry (2).

Protein lysates (30 µg of

protein/lane) were heated to 60oC for 15' and resolved by SDS-PAGE on 10% polyacrylamide minigels (Bio-Rad, Hercules, CA).

Gels

were transferred

electrophoretically to nitrocellulose membranes and blocked with 5 g/dl nonfat dry milk.

Membranes were then incubated with an anti-αENaC antibody (αENaC

antibody 3560-2[4]; [IgG]=0.518 µg/ml) overnight at 4oC in a diluent containing 150 mM NaCl, 50 mM Na phosphate, pH 7.5, 10 mg/dl Na azide, 50 mg/dl Tween-20, and 1 g/dl bovine serum albumin (30).

After a series of washes, membranes were

exposed to anti-rabbit IgG conjugated to horseradish peroxidase (Pierce, Rockford, IL) at 0.16 µg/ml.

Luminol-based enhanced chemiluminescence (LumiGLO,

Kirkegaard and Perry Laboratories, Gaithersburg, MD) was used to detect antibodyantigen binding upon exposure to light-sensing film. Appropriate bands were then analyzed using densitometry (Molecular Dynamics, San Jose, CA).

9

Transient transfection and analysis of reporter activity. The organization of the 5′ end of the hαENaC gene has previously been described (33, 53). A portion of the 5' flanking region of the hαENaC gene (-487+ 55), which contains the functional glucocorticoid response element (GRE) was cloned upstream of the firefly luciferase gene in the plasmid pGL3basic (Promega). The GRE of hαENaC,

AGAACAgaaTGTCCT,

was

mutated

within

this

plasmid

to

AGTCTAgaaTGTCCT using the Quikchange Site-Directed Mutagenesis Kit (Stratagene,

La

Jolla,

CA)

and

CAGTGTAAAGAAGTCTAGAATGTCCTAGGGCCC GGGCCCTAGGACATTCTAGACTTCTTTACACTG.

primers and

Briefly,

the

5′ 5′

-487

+55

construct in pGL3basic was annealed with the above primers, extended with Pfu DNA polymerase, and the parental plasmid then digested with Dpn I and the extended circular double stranded DNA molecule (-487 +55 mutGRE) recovered by transformation into bacteria. A549 and HEK 293 cells were grown in 24-well plates till sub-confluent and then transfected, using LipofectAMINE Plus (Life Technologies, Gaithersburg, MD), with 1 µg of the αENaC promoter-reporter construct and 1 µg of pRL-SV40 (Promega) as a control for transfection efficiency. For HEK293 experiments, TAT3luc, a plasmid where 3 tandem copies of the GRE in the rat tyrosine amino transferase gene was placed upstream of a TATA-driven firefly luciferase construct, was tested (29).

The day after transfection, cells were treated with 100 nM

dexamethasone or vehicle and 24 hr later cell lysates were prepared and reporter gene activity were performed as previously described (33).

10

Patch clamp of H441 cells. H441 cells were grown on Transwell-clear filter (Costar Corp., Cambridge, MA) for 4 days in RPMI 1640 containing 6% fetal bovine serum and 100 nM dexamethasone and then for 2 days in serum free RPMI containing 100 nM dexamethasone. Prior to patch clamp analysis, the Isc for each filter was measured in an Ussing chamber and ranged between 5 and 7 µA/cm2. Single channel currents were measured in cell-attached patches while cells were superfused at 37°C, using an Axopatch 2B voltage clamp amplifier under the control of the pClamp software suite (Axon Instruments, Burlingame, CA), as described earlier (57). The bathing solution contained 140 mM NaCl, 4.5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, 10 mM Hepes, 5 mM D-glucose, pH 7.35 and the pipette solution contained 140 mM LiCl, 3 mM MgCl2, 10 mM Hepes, pH 7.35.

Slope conductance was calculated using

pClamp software (Axon Instruments).

11

RESULTS. We have previously shown, by short-circuit current (Isc) measurements, that H441 cells express a glucocorticoid-regulated Na+ transport pathway (44). To begin to determine the basis for regulation of Na+ transport we first measured the time course for the glucocorticoid -mediated stimulation of Isc in H441 cells grown on permeable supports. Isc begins to increase after 4 hr of glucocorticoid exposure and is clearly elevated by 6 hr (Fig. 1A). The current continues to increase over the next 18 hr and, as we have previously reported, almost all the current is inhibited by 10 µM benzamil, an epithelial Na+ channel inhibitor (44). In the control cells, there was a slow decline in Isc over 24 hr, which was not related to a change in resistance and may have been secondary to the continued serum and steroid deprivation.

The

results confirm that glucocorticoids increase benzamil-sensitive Na+ transport, consistent with an increase in ENaC function. We next determined, by RPA, if ENaC subunit mRNAs were regulated by glucocorticoids in H441 cells. The effect of 100 nM dexamethasone on ENaC mRNA from H441 cells grown on filters was examined at different time points. The results demonstrate that dexamethasone increased the expression of all three subunits in a time dependent manner, with a different profile for each of the three subunits. Under basal conditions, whereas there was abundant expression of αENaC, β and γENaC expression were not identifiable (Fig, 1B,C). In the presence of dexamethasone, αENaC mRNA levels increase significantly by 4 hr and continued to increase over the next several hr. The γENaC subunit mRNA was substantially increased as early as 2 hr, the earliest time point tested, and continued to increase up to 24 hr, while the

12

βENaC subunit was only increased at 24 hr.

When coupled with the Na+ transport

data in Fig. 1A, the results show that the increase in γ and αENaC mRNA levels occur prior to an increase in Na+ transport and suggest that the increase in transport may be accompanied by an increase in some subunit proteins.

The data also

indicates that an increase in expression of βENaC mRNA may not be required for the early glucocorticoid effect on Na+ transport in H441 cells.

To assess if the

glucocorticoid regulation of α,β and γENaC mRNA were qualitatively different if the cells were grown on solid supports, the expression of these three subunits was also determined in H441 cells grown in polystyrene cell culture flasks. While a careful time course analysis was not performed the data showed that glucocorticoids stimulate α,β and γENaC expression in a similar fashion (data not shown). We then determined the dose-response curve for dexamethasone at 24 hr for each of the three subunits when H441 cells were grown on solid supports. Under steroid-free conditions αENaC expression was easily detectable, while β and γENaC expression was difficult to identify and dexamethasone increased the expression of each of the three mRNAs in a dose dependent manner (Fig. 2A, B, C). To determine if the increase in ENaC mRNA is accompanied by an increase in ENaC protein, cell lysates from glucocorticoid- and vehicle-treated H441 cells were immunoblotted with specific polyclonal antibodies raised against the rat α and γENaC proteins (30).

The results clearly demonstrate that there is a two to three-fold

increase in αENaC protein following exposure to 100 nM dexamethasone for 24 hr (Fig. 3). We were unable to detect β or γENaC protein in these cells using our

13

antibody, which may relate to abundance of the protein or the affinity of the antibodies for the human protein. The finding that all three ENaC subunits are regulated by glucocorticoids in H441 cells prompted us to examine ENaC mRNA expression in A549 cells. Recently, Lazrak et al., reported that A549 cells, a human type II alveolar epithelial cell line, has glucocorticoid-stimulated amiloride-inhibitable Na+ transport with regulated expression of some ENaC subunits (26, 27). Our results show that all three subunits are not detectable by RPA under basal conditions but are induced by stimulation with 100 nM dexamethasone. While αENaC mRNA is evident as early as 2 hr after stimulation, β and γENaC expression was only evident at later time points (Fig. 4A, B, C) There is increasing evidence that a serum and glucocorticoid regulated kinase (sgk1) may be responsible, at least in part, for the corticosteroid-mediated increase in Na+ transport in amphibian, rabbit and rat kidney (13, 34). The mRNA for sgk1 is rapidly induced by glucocorticoids and aldosterone and co-expression of sgk1 with α, β and γENaC subunits in Xenopus oocytes leads to an increase in Na+ transport. This effect of sgk is achieved by increasing the number of ENaC channels assembled at the cell surface (16). The increase in sgk1 mRNA by glucocorticoids was first noted in rat mammary epithelia and have also been reported in the canine collecting duct and in some human epithelial cell lines (33, 35, 64), though when first cloned, the human sgk1 (hsgk1) transcript did not appear to be regulated by glucocorticoids (58). Recently, two related transcripts, sgk2 and sgk3 have been cloned from human tissues, and these gene products also possess similar kinase

14

activity (25). We first asked if any of the sgk isoforms were expressed in H441 cells. We were able to clone each of the hsgk isoforms by RT-PCR confirming that all sgk isoforms are expressed in these cells (Fig. 5A). To examine their regulation, we measured steady state levels of hsgk transcripts by RPA in H441 cells. Our results clearly demonstrate that hsgk1 is increased by corticosteroid treatment with a maximal effect seen at 1 hr (Fig. 5B). Hsgk3 is not induced by corticosteroids (data not shown) while hsgk2 was not identifiable by RPA in H441 cells and its regulation was not further examined. We next asked if the effect of glucocorticoids on ENaC subunits and sgk1 in H441 cells were at a transcriptional level and if protein synthesis was required. We have previously shown that the glucocorticoid and mineralocorticoid effect on αENaC expression on human and canine αENaC expression was transcriptional (33, 44) so these experiments were restricted to γ and βENaC and sgk1 transcripts. The effect of dexamethasone on β,γ ENaC and sgk1 expression was abolished by simultaneous treatment

with

actinomycin

D

providing

strong

supportive

evidence

that

glucocorticoids increase transcription of β and γENaC subunits (Fig. 6A, B). Cycloheximide, a protein synthesis inhibitor, had no effect on basal levels of β and γENaC and appeared to augment dexamethasone-induced γ and βENaC expression (Fig. 6A, B), suggesting that a labile intermediary protein expressed in H441 cells may inhibit the glucocorticoid effects on these genes. In contrast to the results seen with β and γENaC, cycloheximide superinduced basal and corticosteroid-stimulated sgk1 mRNA expression (Fig. 6C).

15

Since hsgk1 was transcriptionally regulated by glucocorticoids in one human epithelial cell line we asked if other human epithelial cells would also show similar regulation. We evaluated hsgk1 expression by RPA in A549 cells and in a human embryonic

kidney cell line,

HEK293.

Hsgk1

was

rapidly increased

dexamethasone in A549 cells but not in HEK293 cells (Fig. 7A, B).

by

To further

explore the differential glucocorticoid response in these cell lines, we expressed a luciferase-coupled human αENaC promoter-enhancer in A549 cells. This promoterenhancer construct contains the functional GRE of the hαENaC gene (44) and the data shows that reporter gene activity was robustly stimulated by dexamethasone in A549 cells (Fig. 7C).

This response was predictable since the human αENaC

transcript, at least in our studies, is induced by dexamethasone (Fig. 4A). Consistent with our previous studies, a targeted mutation of the αENaC GRE abolished the dexamethasone response confirming that the GRE in the αENaC gene is necessary and sufficient for glucocorticoids to stimulate αENaC transcription in A549 cells. The inability of glucocorticoids to stimulate hsgk1 expression in HEK293 cells is not due to the absence of a functional glucocorticoid receptor (GR), since the plasmid TAT3luc is fully responsive to glucocorticoids, and likely indicates that unidentified cofactors may modulate glucocorticoid-regulation of sgk in specific epithelia. Given that all three ENaC subunits were regulated by corticosteroids we hypothesized that the corticosteroid-stimulated Na+ transport in H441 cells occurred via a classic ENaC hetero-multimeric complex.

To determine the biophysical

properties of H441 Na+ channels, glucocorticoid-stimulated cells grown on permeable supports were subjected to patch clamp analysis at 37oC with Li+ in the pipette. All

16

patches were made on the apical membrane in the cell-attached mode and channels were rarely seen. When channels were occasionally identified, the single channel traces showed very long open and closed times (several hundred msec, usually), a well-known characteristic of ENaC channels. The open channel current amplitude for various voltages was measured and an I/V plot generated (Fig. 8). Linear regression analysis of these points gives a slope conductance of 10.8 pS. Extrapolation of the conductance line indicates a very positive reversal potential indicative of a Na+selective channel. These characteristics are indistinguishable from ENaC channels heterologously expressed in Xenopus oocytes (53). Another signaling pathway with direct effects on Na+ transport in airway epithelial cells involves the stimulation of cAMP as occurs, for example, with epinephrine stimulation (38). To determine if the H441 cell is a model to study cAMP regulation of Na+ transport we used forskolin, a direct activator of adenylyl cyclase and IBMX, a phosphodiesterase inhibitor, to elevate intracellular cAMP levels. When grown on permeable supports, cAMP stimulation led to a substantial increase in short circuit current after 24 hr in these cells (Fig. 9A). To confirm that the increase in current was due to Na+ transport and not Cl- secretion the effect of 10 µM benzamil on basal and stimulated Isc was examined. The results demonstrate that almost all the current is benzamil-sensitive thus excluding a significant contribution from Clsecretion (Fig. 9A). To examine the effect of corticosteroids and cAMP stimulation together, the effect of these agents on Isc was measured. The results show that forskolin/IBMX stimulation further enhanced the effect of corticosteroids on Isc and that the effect appeared to be more than additive (Fig. 9B). Finally, we examined the

17

time course of the forskolin/IBMX effect short circuit current, cAMP stimulation on Isc was fairly rapid with an effect that was obvious within 5 minutes and this Isc remained persistently elevated (Fig. 9C). When 10 µM benzamil was added to the apical surface, the current was completely abolished thus confirming that almost all electrogenic ion transport could be accounted for by Na+ entry at the apical membrane.

18

DISCUSSION. In this paper we report that glucocorticoids regulate the expression of α, β and γENaC and sgk1 mRNA in two human lung cell lines. The H441 cell line, established from the pericardial fluid of a patient with papillary adenocarcinoma of the lung, expresses the Clara cell 10 Kd (CC-10) protein, the surfactant proteins A, B and D and has the morphological characteristics of a bronchiolar epithelial cell line of Clara cell lineage (20, 39, 43, 50). We have recently reported that glucocorticoids stimulate amiloride-sensitive Na+ transport in this cell line and that this correlates with the regulated expression of αENaC (44), similar to that reported in primary cultures of fetal and adult rat lung epithelial cells (11, 15). We now report that glucocorticoids increase the expression of β,γ ENaC and sgk1 in this cell line. The A549 cell line, also established from a lung adenocarcinoma, displays characteristics that are more typical of alveolar type II cells yet they do not express any of the surfactant genes (8, 47). Recently, the biophysical properties of Na+ channels and expression profile of ENaC mRNA in A549 cells and their modulation by glucocorticoids were reported (26, 27). In this study, 24 to 48 hr after stimulation with 1 µM dexamethasone the authors demonstrated a 17-fold increase in γENaC mRNA, a 1.6 fold increase in βENaC mRNA and no increase in αENaC mRNA by RT-PCR. To our knowledge this is the first report of a lung epithelial cell where αENaC mRNA is not regulated by glucocorticoids. Our results are different and clearly show a substantial and early increase in αENaC mRNA in A549 cells when stimulated with 100 nM dexamethasone (Fig. 4 A). This result is in agreement with studies done by others and us, demonstrating that the glucocorticoid responsive enhancer of the human

19

αENaC gene is functional in A549 cells ((62) and Fig. 7C). The studies reported in this paper provide clear evidence that glucocorticoids regulate expression of all three subunits in these human lung epithelial cell lines.

The reason for the apparent

discrepancy from the previously published work is not clear, but may result from dissimilar culture conditions and/or different methods for measurement of RNA levels The finding that all three ENaC subunits are regulated by glucocorticoids in these cell lines was, at first, a little surprising since many investigators have reported that corticosteroids increase expression of αENaC but not β and γENaC mRNA in the fetal and mature rodent lung (48, 52).

Developmental studies in the rat lung

demonstrate that while αENaC mRNA expression shows a dramatic increase at the time of birth coinciding with the perinatal glucocorticoid surge, expression of β and γENaC mRNA is either not evident or increases modestly prior to birth (52, 63). Analysis of the available literature, however, suggests that developmental expression and glucocorticoid regulation of ENaC subunits may be different in the human lung and in derived epithelia. Human (21 week gestation) fetal lung explants express α, β and γENaC mRNA in culture and all three subunits are further regulated by glucocorticoids (55).

Using specific polyclonal antisera against β and γENaC

subunits, Gaillard et. al., recently demonstrated β and γENaC subunit protein expression as early as 17 weeks of gestation in human bronchial and bronchiolar epithelium and by 30 weeks of gestation in a pattern similar to adult airways (18). Further evidence that the fetal and perinatal regulation of ENaC expression are different in humans compared to rodents is the difference in lung phenotype between patients who have homozygous loss of function mutations in the αENaC subunit and

20

mice where the αENaC subunit has been inactivated. While the human mutation causes a severe renal disease, pseudohypoaldosteronism type 1 with salt wasting, hypotension and hyperkalemia, the lung phenotype is milder with a tendency to increased airway fluid and a chronic cough (12, 24, 45).

By contrast, αENaC

knockout mice die within a few hours of birth from inadequate lung liquid absorption (22). Glucocorticoids increase the mRNA levels for α,β and γENaC subunits and sgk1 in a cell and tissue-specific fashion. An imperfect palindromic GRE in the 5' flanking region of the human and rat αENaC gene is necessary and sufficient for the glucocorticoid regulation of the αENaC subunit (28, 33, 40, 44). Similarly, a GRE in the 5' flanking region of the rat sgk1 gene is required for the steroid regulation of sgk1 (65).

The temporal profile of expression of sgk1 and αENaC following

glucocorticoid stimulation are quite different, with sgk1 transcript levels that peak within 1 hr while increases in αENaC mRNA levels are only evident by 2 hr and then continue to increase for 24 to 48 hr. These differences probably arise, in part, from complex regulation by additional transcription factors that modulate the rate of glucocorticoid-dependent transcription of individual genes and, in part, from differences in mRNA stability. Furthermore, all tissues that express GR do not show glucocorticoid-regulation of αENaC and sgk1, indicating that cell-specific coactivators and/or repressors determine spatial expression of these genes. The lack of regulation of hsgk1 in the HepG2 cell line, a cell line where GR is clearly expressed, was interpreted by Waldegger et al., as indicating that the human sgk1 transcript, in contrast to amphibian and rodent sgk1 was not regulated by

21

corticosteroids (58). In support of this hypothesis, the authors were unable to locate a GRE in the proximal 2.4 kb of the 5' flanking region of the hgsk1 gene (59). Our studies with two human lung cell lines clearly indicate that hsgk1 is regulated by glucocorticoids and, at least in the H441 cell line, this effect is transcriptional. These studies are in agreement with recently published studies demonstrating that sgk1 is a glucocorticoid-regulated transcript in several human cell lines (35).

Our findings

suggest that hsgk1 may be regulated by a GRE within the transcriptosome of the hsgk1 gene but that this element may be further 5' and flanking, 3' and flanking or elsewhere within the gene. Glucocorticoids also regulate βENaC and γENaC mRNA levels in H441 and A549 cells, and based on the ability of actinomycin D to abolish glucocorticoiddependent expression, this effect is likely to be at the level of gene transcription. We have cloned and characterized the 5' flanking region of hγ and βENaC genes and have not yet identified a functional glucocorticoid responsive enhancer ((1) and 1). This could indicate that the glucocorticoid-dependent regulation of β and γENaC is not transcriptional, though it is more likely that the enhancer elements are located elsewhere in the genome. At the present time, we can only conclude that while αENaC and sgk1 are regulated by GREs, the molecular basis for glucocorticoid regulation of β and γENaC remains unknown. The biophysical properties of Na+ channels in alveolar and airway epithelial cells have been studied by single channel analysis. Several types of channels have been identified including calcium-activated non-selective and Na+-selective cation

1

Thomas, C.P. et al., Manuscript in preparation.

22

channels and a calcium-insensitive Na+-selective channel (for review see (31). The calcium-insensitive Na+ channel identified in rat FDLE cells has conductance of 4.4 pS, is highly Na+ selective and has long open and slow times very similar to the properties of α,β,γ ENaC-reconstituted Na+ channels in Xenopus oocytes (10, 56). Na+-selective channels were also identified by patch clamp analysis of A549 cells, where dexamethasone increased channel open time and open probability and altered channel conductance from 8.6 to 4.4 pS (26, 27). In this paper we report that H441 cells express a Na+-selective channel with a conductance of 10.8 pS when measurements were performed at 37oC and using Li+ as the charge carrier. The kinetic properties of the channel seen in H441 cells are very typical of ENaC channels. When heterologously expressed in Xenopus oocytes, and measurements made at 22oC with Li+ in the pipette, the human ENaC subunits reconstitute a Na+ selective channel with a slope conductance of ~ 7 pS (53). We believe that these channels cannot be distinguished from the 4.4 pS channel seen in FDLE and corticosteroid-treated A549 cells (27, 56).

The disparity in channel conductance

between the H441 channel and those reported from Na+ selective channels in FDLE and A549 probably reflect differences in the temperature at which measurements were made and the use of Li+ rather than Na+ as the charge carrier (41, 42). Our results also suggest that the ENaC hetero-multimer is the ion channel responsible for Na+ transport in H441 cells, at least under glucocorticoid-treated conditions. We are unable to comment on the properties of Na+ channels in H441 cells not stimulated with glucocorticoids since these channels were very difficult to identify. Recently, Jain and colleagues demonstrated that the alveolar type II cell expression of a highly

23

selective Na+ channel with ENaC-type properties was substantially enhanced when these cells were exposed to corticosteroids and grown on permeable supports in the presence of an air-liquid interface (23). The significance of the Ca2+-activated and non-selective cation channels that have been previously reported from a variety of lung epithelial cells is not entirely clear but could be attributed to the substrate on which the cells are grown, the culture conditions and to the patch configuration in those studies. In addition to glucocorticoids, amiloride-inhibitable Na+ transport in airway epithelia can be regulated by arginine vasopressin (AVP) and by catecholamines (6, 14, 21). Catecholamines and AVP are thought to act via their second messenger cAMP since their effects can be mimicked by membrane permeant analogs of cAMP (5, 61).

We use forskolin and IBMX to increase cAMP levels and show that

amiloride-sensitive Na+ transport is increased in H441 cells. This increase is seen even in the absence of glucocorticoids and more importantly, cAMP stimulation potentiates the effect seen with glucocorticoids, suggesting that these agonists activate distinct pathways.

In contrast to the effect of glucocorticoids on Na+

transport, which takes hours, the effect of forskolin/IBMX is seen within minutes and persist for at least 24 hr, suggesting that post-transcriptional and transcriptional mechanisms are likely to play a part in this effect. In comparison, cAMP stimulation of amiloride-sensitive Na+ current in fetal rat alveolar epithelial cells was seen at 8 hr, the first time point reported, and there was no additive effect with glucocorticoids (15).

The increase in Na+ transport seen with cAMP in these primary cultures

correlated with an increase in αENaC mRNA expression, similar to results we have

24

seen in H441 cells (data not shown). The H441 cell line thus appears to be a good model to study glucocorticoid and cAMP regulated Na+ transport mediated by ENaC.

25

ACKNOWLEDGEMENTS. Portions of the work submitted here were presented in abstract form at the American Thoracic Society meeting in 2000. This work was supported in part by grants-in-aid from March of Dimes Birth Defects Foundation Research Grant #6-FY99-444, by USPHS grants DK54348 and DK52617, by a grant from the Department of Veteran's Affairs and by a Career Investigator Award from the American Lung Association to CPT. The authors thank Kang Liu for excellent technical support, Paul McCray for the gift of a human βENaC cDNA clone, David Pearce and Keith Yamamoto for the TAT3-luc cDNA clone and acknowledge the DNA synthesis and sequencing services provided by the University of Iowa DNA core facility.

Abbreviations: ENaC, epithelial sodium channel; FDLE, fetal distal lung epithelial cells; sgk, serum and glucocorticoid regulated kinase; IBMX, 3-isobutyl-1methylxanthine; Isc, short-circuit current; RPA, ribonuclease protection assay; CC10, Clara cell 10 Kd; GRE, glucocorticoid response element; GR; glucocorticoid receptor; cDNA, DNA complementary to RNA; AVP, arginine vasopressin

26

REFERENCES. 1.

Auerbach, S. D., R. W. Loftus, O. A. Itani, and C. P. Thomas. The human

amiloride-sensitive epithelial sodium channel gamma subunit promoter: Functional analysis and identification of a polypurine-polypyrimidine tract with the potential for triplex DNA formation. Biochem J 347: 105-114, 2000. 2.

Avruch, J., and D. F. Wallach. Preparation and properties of plasma

membrane and endoplasmic reticulum fragments from isolated rat fat cells. Biochim Biophys Acta 233: 334-47., 1971. 3.

Barbry, P., and P. Hofman. Molecular Biology of Na+ absorption. Am J Physiol

273: G571-G585, 1997. 4.

Barker, P. M., M. Markiewicz, K. A. Parker, D. V. Walters, and L. B. Strang.

Synergistic action of triiodothyronine and hydrocortisone on epinephrine-induced reabsorption of fetal lung liquid. Pediatr Res 27: 588-591, 1990. 5.

Berthiaume, Y. Effect of exogenous cAMP and aminophylline on alveolar and

lung liquid clearance in anesthetized sheep. J Appl Physiol 70: 2490-2497, 1991. 6.

Berthiaume, Y., N. Staub, and M. Mathay. Beta-adrenergic agonists increase

lung liquid clearance in anesthetized sheep. J Clin Invest 79: 335-43, 1987. 7.

Bland, R., and D. Nielson. Developmental changes in lung epithelial ion

transport and liquid movement. Annu Rev Physiol 54: 373-94, 1992. 8.

Braun, H., and G. Suske. Combinatorial Action of HNF3 and Sp Family

Transcription Factors in the Activation of the Rabbit Uteroglobin/CC10 Promoter. J Biol Chem 273: 9821-9828, 1998.

27

9.

Brennan, F. E., and P. J. Fuller. Rapid upregulation of serum and

glucocorticoid-regulated kinase (sgk) gene expression by corticosteroids in vivo. Mol Cell Endocrinol 166: 129-36, 2000. 10.

Canessa, C. M., L. Schild, G. Buell, B. Thorens, I. Gautschi, J. D. Horisberger,

and B. C. Rossier. Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature 367: 463-467, 1994. 11.

Champigny, G., N. Voilley, E. Lingueglia, V. Friend, P. Barbry, and M.

Lazdunski. Regulation of expression of the lung amiloride-sensitive Na+ channel by steroid hormones. EMBO J 13: 2177-2181, 1994. 12.

Chang, S. S., S. Grunder, A. Hanukoglu, A. Rosler, P. M. Mather, I.

Hanukoglu, L. Schild, Y. Lu, R. A. Shimkets, C. Nelson-Williams, B. C. Rossier, and R. P. Lifton. Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalemic acidosis, pseudohypoaldosteronism type 1. Nat Genetics 12: 248253, 1996. 13.

Chen, S. Y., A. Bhargava, L. Mastroberardino, O. C. Meijer, J. Wang, P. Buse,

G. L. Firestone, F. Verrey, and D. Pearce. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci U S A 96: 2514-9, 1999. 14.

Crandall, E., T. Heming, R. Palombo, and B. Goodman. Effect of terbutaline

on sodium transport in isolated perfused rat lung. J Appl Physiol 60: 289-294, 1986. 15.

Dagenais, A., C. Denis, M. F. Vives, S. Girouard, C. Masse, T. Nguyen, T.

Yamagata, C. Grygorczyk, R. Kothary, and Y. Berthiaume. Modulation of alphaENaC and alpha1-Na+-K+-ATPase by cAMP and dexamethasone in alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 281: L217-30., 2001.

28

16.

de La Rosa, D. A., P. Zhang, A. Naray-Fejes-Toth, G. Fejes-Toth, and C. M.

Canessa. The serum and glucocorticoid kinase sgk increases the abundance of epithelial sodium channels in the plasma membrane of xenopus oocytes. J Biol Chem 274: 37834-9, 1999. 17.

Folkesson, H. G., A. Norlin, Y. Wang, P. Abedinpour, and M. A. Matthay.

Dexamethasone and thyroid hormone pretreatment upregulate alveolar epithelial fluid clearance in adult rats. J Appl Physiol 88: 416-424, 2000. 18.

Gaillard, D., J. Hinnrasky, S. Coscoy, P. Hofman, M. A. Matthay, E. Puchelle,

and P. Barbry. Early expression of beta - and gamma -subunits of epithelial sodium channel during human airway development. Am J Physiol 278: L177-184, 2000. 19.

Garty, H., and L. G. Palmer. Epithelial sodium channels: function and

regulation. Physiol Rev 77: 359-396, 1997. 20.

George, T. N., O. L. Miakotina, K. L. Goss, and J. M. Snyder. Mechanism of all

trans-retinoic acid and glucocorticoid regulation of surfactant protein mRNA. Am J Physiol 274: L560-6, 1998. 21.

Hooper, S. B., M. J. Wallace, and R. Harding. Amiloride blocks the inhibition of

fetal lung liquid secretion caused by AVP but not by asphyxia. J Appl Physiol 74: 111-5, 1993. 22.

Hummler, E., P. Barker, J. Gatzy, F. Beermann, C. Verdumo, A. Schmidt, R.

Boucher, and B. C. Rossier. Early death due to defective neonatal lung liquid clearance in αENaC-deficient mice. Nat Genetics 12: 325-328, 1996.

29

23.

Jain, L., X. J. Chen, S. Ramosevac, L. A. Brown, and D. C. Eaton. Expression

of highly selective sodium channels in alveolar type II cells is determined by culture conditions. Am J Physiol Lung Cell Mol Physiol 280: L646-58., 2001. 24.

Kerem, E., T. Bistritzer, A. Hanukoglu, T. Hofman, Z. Zhou, W. Bennett, E.

MacLaughlin, P. Barker, M. Nash, L. Quittell, R. Boucher, and M. R. Knowles. Pulmonary epithelial sodium-channel dysfunction and excess airway liquid in pseudohypoaldosteronism. New England J Med 341: 156-162., 1999. 25.

Kobayashi, T., M. Deak, N. Morrice, and P. Cohen. Characterization of the

structure and regulation of two novel isoforms of serum- and glucocorticoid-induced protein kinase. Biochem J 344 Pt 1: 189-97, 1999. 26.

Lazrak, A., A. Samanta, and S. Matalon. Biophysical properties and molecular

characterization of amiloride-sensitive sodium channels in A549 cells. Am J Physiol 278: L848-857, 2000. 27.

Lazrak, A., A. Samanta, K. Venetsanou, P. Barbry, and S. Matalon.

Modification of biophysical properties of lung epithelial Na(+) channels by dexamethasone. Am J Physiol 279: C762-C770, 2000. 28.

Lin, H. H., M. D. Zentner, H.-L. L. Ho, K.-J. Kim, and D. K. Ann. The gene

expression of the amiloride-sensitive epithelial sodium channel α-subunit is regulated by antagonistic effects between glucocorticoid hormone and ras pathways in salivary epithelial cells. J Biol Chem 274: 21544-21554, 1999. 29.

Liu, W., J. Wang, N. Sauter, and D. Pearce. Steroid receptor

heterodimerization demonstrated in vitro and in vivo. Proc Natl Acad Sci U S A 92: 12480-12484, 1995.

30

30.

Masilamani, S., G. H. Kim, C. Mitchell, J. B. Wade, and M. A. Knepper.

Aldosterone-mediated regulation of ENaC alpha, beta, and gamma subunit proteins in rat kidney. J Clin Invest 104: R19-23, 1999. 31.

Matalon, S., and H. O'Brodovich. Sodium channels in alveolar epithelial cells:

molecular characterization, biophysical properties and physiological significance. Annu Rev Physiol 61: 627-661, 1999. 32.

McNicholas, C. M., and C. M. Canessa. Diversity of channels generated by

different combinations of epithelial sodium channel subunits. J Gen Physiol 109: 681692, 1997. 33.

Mick, V. E., O. A. Itani, R. W. Loftus, R. F. Husted, T. J. Schmidt, and C. P.

Thomas. The α subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5' flanking region of the gene. Mol Endocrinol 15: 575-588, 2001. 34.

Naray-Fejes-Toth, A., C. Canessa, E. S. Cleaveland, G. Aldrich, and G. Fejes-

Toth. sgk is an aldosterone-induced kinase in the renal collecting duct. J Biol Chem 274: 16973-16978, 1999. 35.

Naray-Fejes-Toth, A., G. Fejes-Toth, K. A. Volk, and J. B. Stokes. SGK is a

primary glucocorticoid-induced gene in the human. J Steroid Biochem Mol Biol 75: 51-56, 2000. 36.

O'Brodovich, H. Epithelial ion transport in the fetal and perinatal lung. Am J

Physiol 261: 555-564, 1991.

31

37.

O'Brodovich, H. M. Immature epithelial Na+ expression is one of the

pathogenetic mechanisms leading to human neonatal respiratory distress syndrome. Proceedings of the Association of American Physicians 108: 345-355, 1996. 38.

Olver, R., C. Ramsden, L. Strang, and D. Walters. The role of amiloride-

blockable sodium transport in adrenaline-induced lung liquid reabsorption in the fetal lamb. J Physiol (London) 376: 321-340, 1986. 39.

O'Reilly, M., A. Gazdar, R. Morris, and J. Whitsett. Differential effects of

glucocorticoid on expression of surfactant proteins in a human lung adenocarcinoma cell line. Biochim Biophys Acta 970: 194-204, 1988. 40.

Otulakowski, G., B. Rafii, H. R. Bremner, and H. O'Brodovich. Structure and

hormone responsiveness of the gene encoding the alpha-subunit of the rat amiloridesensitive epithelial sodium channel. Am J Respir Cell Mol Biol 20: 1028-1040, 1999. 41.

Palmer, L. G. Epithelial Na+ channels: function and diversity. Annu Rev

Physiol 54: 51-66, 1992. 42.

Palmer, L. G., and G. Frindt. Conductance and gating of epithelial Na+

channels from rat cortical collecting tubule. Effects of luminal Na+ and Li+. J Gen Physiol 1: 121-138, 1988. 43.

Rust, K., L. Bingle, M. W, A. Persson, and E. Crouch. Characterization of the

human surfactant protein D promoter: transcriptional regulation of SP-D gene expression by glucocorticoids. Am J Respir Cell Mol Biol 14: 121-130, 1996. 44.

Sayegh, R., S. D. Auerbach, X. Li, R. Loftus, R. Husted, J. B. Stokes, and C.

P. Thomas. Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans-activation of a hormone response element in the

32

5' flanking region of the human epithelial sodium channel α subunit gene. J Biol Chem 274: 12431-12437, 1999. 45.

Schaedel, C., L. Marthinsen, A.-C. Kristoffersson, R. Kornfalt, K. O. Nilsson, B.

Orlenius, and L. Holmberg. Lung symptoms in pseudohypoaldosteronism type 1 are associated with deficiency of the α-subunit of the epithelial sodium channel. J Pediatrics 135: 739-745, 1999. 46.

Shigaev, A., C. Asher, H. Latter, H. Garty, and E. Reuveny. Regulation of sgk

by aldosterone and its effects on the epithelial Na(+) channel. Am J Physiol 278: F613-9, 2000. 47.

Smith, B. Cell line A549: a model system for the study of alveolar type II cell

function. Am Rev Respir Dis 115: 285-293, 1977. 48.

Stokes, J. B., and R. D. Sigmund. Regulation of rENaC mRNA by dietary NaCl

and steroids: organ, tissue and steroid heterogeneity. Am J Physiol 274: C1699C1707, 1998. 49.

Strang, L. B. Fetal lung liquid: secretion and reabsorption. Physiol Rev 71:

991-1016, 1991. 50.

Suske, G., W. Lorenz, J. Klug, A. Gazdar, and M. Beato. Elements of the

rabbit uteroglobin promoter mediating its transcription in epithelial cells from the endometrium and lung. Gene Expr 2: 339-352, 1992. 51.

Talbot, C. L., D. G. Bosworth, E. L. Briley, D. A. Fenstermacher, R. C.

Boucher, S. E. Gabriel, and P. M. Barker. Quantitation and localization of ENaC subunit expression in fetal, newborn, and adult mouse lung. Am J Respir Cell Mol Biol 20: 398-406, 1999.

33

52.

Tchepichev, S., J. Ueda, C. M. Canessa, B. C. Rossier, and H. M.

O'Brodovich. The lung epithelial Na+ channel subunits are differentially regulated during development and by steroids. Am J Physiol 269: C805-812, 1995. 53.

Thomas, C. P., S. D. Auerbach, J. B. Stokes, and K. A. Volk. 5' heterogeneity

in amiloride-sensitive epithelial sodium channel alpha subunit mRNA leads to distinct NH2-terminal variant proteins. Am J Physiol 274: C1312-1323, 1998. 54.

Thomas, C. P., N. A. Doggett, R. Fisher, and J. B. Stokes. Genomic

organization and the 5' flanking region of the gamma subunit of the human amiloridesensitive epithelial sodium channel. J Biol Chem 271: 26062-26066, 1996. 55.

Venkatesh, V. C., and H. D. Katzberg. Glucocorticoid regulation of epithelial

sodium channel genes in human fetal lung. Am J Physiol 273: L227-L233, 1997. 56.

Voilley, N., E. Lingueglia, G. Champigny, M. G. Mattei, R. Waldmann, M.

Lazdunski, and P. Barbry. The lung amiloride-sensitve Na+ channel: Biophysical properties, pharmacology, ontogenesis, and molecular cloning. Proc Natl Acad Sci U S A 91: 247-251, 1994. 57.

Volk, K. A., R. D. Sigmund, P. M. Snyder, F. J. McDonald, M. J. Welsh, and J.

B. Stokes. rENaC is the predominant Na+ channel in the apical membrane of the rat renal inner medullary collecting duct. J Clin Invest 96: 2748-2757, 1995. 58.

Waldegger, S., P. Barth, G. Raber, and F. Lang. Cloning and characterization

of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci U S A 94: 44405, 1997.

34

59.

Waldegger, S., M. Erdel, U. O. Nagl, P. Barth, G. Raber, S. Steuer, G.

Utermann, M. Paulmichl, and F. Lang. Genomic organization and chromosomal localization of the human SGK protein kinase gene. Genomics 51: 299-302, 1998. 60.

Wallace, M. J., S. B. Hooper, and R. Harding. Effects of elevated fetal cortisol

concentrations on the volume, secretion, and reabsorption of lung liquid. Am J Physiol 269: R881-7, 1995. 61.

Walters, D. V., C. A. Ramsden, and R. E. Olver. Dibutyryl cAMP induces a

gestation-dependent absorption of fetal lung liquid. J Appl Physiol 68: 2054-9, 1990. 62.

Wang, H.-C., M. D. Zentner, H.-T. Deng, K.-J. Kim, R. Wu, P.-C. Yang, and D.

K. Ann. Oxidative stress disrupts glucocorticoid hormone-dependent transcription of the amiloride-sensitive epithelial sodium channel alpha -subunit in lung epithelial cells through ERK-dependent and thioredoxin-sensitive pathways. J Biol Chem 275: 86008609, 2000. 63.

Watanabe, S., K. Matsushita, J. Stokes, and P. McCray. Developmental

regulation of epithelial sodium channel subunit mRNA expression in rat colon and lung. Am J Physiol 275: G1227-G1235, 1998. 64.

Webster, M. K., L. Goya, and G. L. Firestone. Immediate-early transcriptional

regulation and rapid mRNA turnover of a putative serine/threonine protein kinase. J Biol Chem 268: 11482-5, 1993. 65.

Webster, M. K., L. Goya, Y. Ge, A. C. Maiyar, and G. L. Firestone.

Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13: 2031-40, 1993.

35

Figure legends. Figure 1. Effect of 100 nM dexamethasone on short circuit current (Isc) and ENaC expression in H441 cells grown on permeable support. A. Dexamethasone (dex), compared to vehicle (ctrl), increases Isc beginning after 4 hr. (*p < 0.05, #p < 0.01, Students t-test, n = 11 + sem) B. Dex increases αENaC mRNA expression in H441 cells in a time dependent manner and significantly by 4 hr. (*p < 0.05, Students t-test, n = 3 + sem).

The ratio of αENaC mRNA/18s rRNA at each time point was

compared to the corresponding level at time 0 which was arbitrarily set at 1. C. Dex increases γENaC mRNA expression at 2 hr which persists for upto 24 hr. The effect of dex on αENaC is also evident at 24 hr and on βENaC is only evident by 24 hr. A representative RPA from 1 of 3 experiments is shown. Figure 2.

Effect of dexamethasone (dex) on α,β,γ ENaC expression - dose

response. H441 cells grown on solid supports, exposed to various concentrations of dex for 24 hr and α (A), β (B) and γENaC (C) expression assessed by RPA. As a control for RNA loading, 18sRNA was simultaneously assessed. Figure 3. Effect of 100 nM dexamethasone (dex) on αENaC protein in H441 cells. H441 cells grown on solid supports, exposed to dex or vehicle (ctrl) for 24 hr and protein expression assessed by Western blot analysis.

A specific band was

detected in all lanes (upper panel) and the results quantitated by densitometry (lower panel. (*p < 0.001, n = 3 + sem). Figure 4. Effect of dexamethasone (dex) on α,β,γ ENaC expression in A549 cells. A549 cells grown on solid supports, exposed to dex for various times and α (A), β (B)

36

and γENaC (C) expression assessed by RPA. As a control for RNA loading, 18sRNA was simultaneously assessed. Figure 5. Human sgk isoforms in H441 cells. A. RT-PCR of H441 RNA identifies sgk1, sgk2 and sgk3 in H441 cells. B. Representative RPA of hsgk1 expression in H441 cells following treatment with dexamethasone (dex) for various time periods. As a control for RNA loading, 18S rRNA was simultaneously assessed. Figure 6. Effect of actinomycin D and cycloheximide on dexamethasone (dex)stimulated γ and βENaC and sgk1 expression in H441 cells. Actinomycin D (act) or cycloheximide (chx) was added simultaneously with vehicle (ctrl) or dex to H441 cells for 24 hr and mRNA levels measured by RPA.

Actinomycin D abolishes dex

stimulated γ (A), β (B) and sgk1 (C) expression. Cycloheximide appears to enhance dex-stimulated stimulated γ (A), β (B) and sgk1 (C) expression and can stimulate sgk1 independently of dex (C). Figure 7. Glucocorticoid regulation of hsgk1 expression and gene transcription in A549 and HEK293 cells. Representative RPA of hsgk1 expression in A549 (A) and HEK293 (B) cells following treatment with dexamethasone (dex) for various time periods. As a control for RNA loading, 18S rRNA was simultaneously assessed. Dex stimulates hsgk1 expression in A549 cells but not in HEK293 cells.

C. The

αENaC promoter-luciferase constructs (-487+55 or -487+55 mutGRE) were transfected into A549 cells and treated with dex or vehicle (ctrl) for 24 hr prior to assay. (*p < 0.001 compared to ctrl, Students t-test, n=4 + sem). The results indicate that dex stimulates αENaC gene transcription in A549 cells.

D. The TAT-3luc

plasmid containing a glucocorticoid-responsive promoter-enhancer coupled to

37

luciferase was transfected into HEK293 cells and treated with dex or vehicle (ctrl) for 24 hr prior to assay. (*p < 0.001 compared to ctrl, Students t-test, n=4 + sem). The results indicate that HEK293 cells contain a functional GR but do not support transcription of the sgk1 gene. Figure 8. Single channel recordings from cell-attached patches in H441 cells. A. The traces shown above were at a holding voltage of -60 mV. Channel openings are downward deflections and there appeared to be only 1 channel in this patch. Note the long open and close times.

B. I-V relationship of current recorded at each

voltage. The slope conductance for this channel with Li in the pipette and measured at 37oC is 10.8 pS. Figure 9. Effect of forskolin and IBMX on short-circuit current in H441 cells. A. H441 cells were exposed to forskolin/IBMX or vehicle (ctrl) for 24 hr and then total and benzamil-sensitive Isc measured.

#

p