Mandibular Hematoma Cells as a Potential Reservoir for Osteoprogenitor Cells in Fractures

J Oral Maxillofac Surg 70:599-607, 2012

Mandibular Hematoma Cells as a Potential Reservoir for Osteoprogenitor Cells in Fractures Takumi Hasegawa, DDS, PhD,* Masahiko Miwa, MD, PhD,† Yoshitada Sakai, MD, PhD,‡ Takahiro Nikura, MD, PhD,§ Sang Yang Lee, MD, PhD,储 Keisuke Oe, MD, PhD,¶ Takashi Iwakura, MD, PhD,# Masahiro Kurosaka, MD, PhD,** and Takahide Komori, DDS, PhD†† Purpose: We hypothesized that cells within the mandibular fracture hematoma played an important

role in mandibular fracture healing. The objective of this study was to analyze cells in human mandibular fracture hematoma. Patients and Methods: We isolated and analyzed human mandibular fracture hematoma cells (MHCs) and investigated whether MHCs had multilineage mesenchymal differentiation capacity in vitro, similar to bone marrow stromal cells (BMSCs). Results: Cell-surface markers showed that the adherent MHCs expressed mesenchymal stem cell– related markers, namely CD29, CD44, CD105, and CD166, while lacking hematopoietic markers CD14, CD34, CD45, and CD133. The proliferative potential, osteogenic potential, and adipogenic potential of MHCs were comparable to those of BMSCs. In contrast, the chondrogenic potential of MHCs was inferior to that of BMSCs. Conclusions: The role of the mandibular fracture hematoma could be as a presumptive local reservoir for osteogenic progenitors and thus contribute to intramembranous bone healing. Our findings may provide new insights into the mechanism of intramembranous bone healing in membranous bone fractures. © 2012 American Association of Oral and Maxillofacial Surgeons J Oral Maxillofac Surg 70:599-607, 2012 Fractures of the lower jaw, also known as mandibular fractures, are the second most common fracture of the face. Thousands of lower-jaw fractures occur annually in the United States. However, few reports have shown the detailed mechanism of mandibular fracture healing. Many investigators have reported the absence of cartilage formation in the healing process of mandibular fractures, which is generally believed to be caused by intramembranous formation only, without cartilage formation.1-5 Mandibular fracture

healing begins with the infiltration of inflammatory cells leading to hematoma, and then, rudimentary neovascular elements form at the fracture site. In the next stage, the osteoprogenitor cells aggregate and form reticulation structures and islands of immature osteoid, which then differentiate into osteoblast, osteoid formation, and calcification.1 In this process the sources of the osteoprogenitor cells have long been unknown. However, several investigators have reported the presence of cartilage formation during the

Received from the Kobe University Graduate School of Medicine, Kobe, Japan. *Clinical Fellow, Department of Oral and Maxillofacial Surgery. †Assistant Professor, Department of Orthopaedic Surgery. ‡Assistant Professor, Department of Orthopaedic Surgery. §Assistant Professor, Department of Orthopaedic Surgery. 储Assistant Professor, Department of Orthopaedic Surgery. ¶Clinical Fellow, Department of Orthopaedic Surgery. #Clinical Fellow, Department of Orthopaedic Surgery. **Professor and Chairman, Department of Orthopaedic Surgery.

††Professor and Chairman, Department of Oral and Maxillofacial Surgery. Address correspondence and reprint requests to Dr Miwa: Department of Orthopaedic Surgery, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe, Hyogo 650-0017, Japan; e-mail: [email protected] © 2012 American Association of Oral and Maxillofacial Surgeons

0278-2391/12/7003-0$36.00/0 doi:10.1016/j.joms.2011.03.043

599

600 healing of membranous bone fracture.6-8 Thus there is general controversy about whether cartilage formation occurs during the healing process of mandibular fracture. In addition, the difference in the mechanism of fracture healing between long bones and membranous bones is not yet well understood. Hematoma occurring at a long bone fracture site is known to play an important role in bone healing. Mizuno et al9 reported that fracture hematoma has an inherent osteogenic potential that contributes significantly to fracture healing. Removal of an organized hematoma some days after fracture was reported to impair bone healing.10 Previous studies have confirmed that several growth factors within the hematoma are central regulators of cellular proliferation and differentiation, as well as matrix synthesis, during the fracture healing process.11,12 Recently, we showed that human long bone fracture hematoma contains progenitor cells with a multilineage mesenchymal differentiation capacity.13 Our study suggested that long bone fracture hematoma cells (LBHCs) with osteogenic/chondrogenic potential might play an important role in both intramembranous and osteochondral healing after long bone fracture. However, to date, no reports have analyzed the detailed characteristics of cells in mandibular fracture hematoma. Therefore the role of hematoma in mandibular fracture healing has not yet been clarified. In this in vitro study, we isolated and analyzed human mandibular fracture hematoma cells (MHCs) and investigated whether MHCs had a multilineage mesenchymal differentiation capacity similar to bone marrow stromal cells (BMSCs).

Patients and Methods PATIENT CHARACTERISTICS

The Institutional Review Board of Kobe University Hospital, Kobe, Japan, approved this study, and informed consent was obtained from all patients involved. Mandibular fracture hematomas were obtained from 9 patients (age range, 18-71 years; mean age, 40.0 years; 9 men) during osteosynthesis 1 to 9 days (mean, 3.4 days) after fracture occurrence (Table 1). All patients underwent rigid fixation through an intraoral approach with a titanium plate and intermaxillary fixation between the maxilla and mandible. Reasons to exclude patients from this study were tumors, autoimmune or other systemic bone-related diseases, or treatment with hormones, anticoagulants, bisphosphonates, steroids, vitamin D, or calcium. As a positive control, bone marrow (BM) samples were obtained with informed consent from 5 patients with a mean age of 45.6 years (age range, 15-75 years) undergoing total hip arthroplasty, and BMSCs were cultured under the same conditions as the MHCs.

MANDIBULAR HEMATOMA CELLS IN FRACTURES

Table 1. PATIENT CHARACTERISTICS

Time After Fracture Patient No. Gender Age (yr) Fracture Site (d) 1 2 3 4 5 6 7 8 9

M M M M M M M M M

60 30 22 47 29 71 18 18 65

Body Body Angle Body Body Body Body Body Body

1 1 1 9 1 9 1 5 3

Hasegawa et al. Mandibular Hematoma Cells in Fractures. J Oral Maxillofac Surg 2012.

ISOLATION AND CULTURE OF MHCS

Hematomas that formed fibrin clots were removed manually before any manipulation or irrigation. The wet weight of hematomas obtained ranged from 0.1 to 0.8 g (mean, 0.31 g). Specimens were then washed with phosphate-buffered saline solution (Wako, Osaka, Japan) to remove blood and were minced with a scalpel into small pieces with growth medium, ␣-Modified Minimum Essential Medium (Sigma, St Louis, MO), containing 10% heat-inactivated fetal bovine serum (FBS) (Sigma), 2-mmol/L L-glutamine (Gibco BRL, Grand Island, NY), and antibiotics. The cultures were incubated in growth medium at 37°C with 5% humidified carbon dioxide. The culture medium was changed twice weekly. Two weeks later, the adherent cells were harvested with 0.05% trypsin/ 0.02% ethylenediaminetetraacetic acid (Wako) and passaged into new culture flasks for further expansion. One or two passage cells were used in the following differentiation assays. IMMUNOPHENOTYPING OF MHCS BY FLOW CYTOMETRY

The adherent cells at passage 1 were harvested, and a total of 5 ⫻ 105 were resuspended with phosphatebuffered saline solution/3% FBS and incubated with the phycoerythrin-conjugated antibodies against CD14, CD29, CD34, CD44, CD45, CD105, CD133, and CD166 for 30 minutes at 4°C. The fluorescence intensity of the cells was analyzed with a FACSaria flow cytometry system (BD Sciences, San Jose, CA). DIFFERENTIATION OF MHCS

Osteogenic Induction Adherent cells were cultured for 21 days in an osteogenic medium consisting of the growth medium plus 10-nmol/L dexamethasone (Sigma), 10-mmol/L ␤-glycerophosphate (Sigma), and 50 ␮g/mL ascorbic acid (Wako).13,14 After 3 weeks, osteogenic differen-

601

HASEGAWA ET AL

tiation was evaluated. The accumulation of mineralized calcium phosphate was assessed by 1% alizarin red S staining (Hartman Leddon, Philadelphia, PA). Expression of osteoblast-related genes, namely alkaline phosphatase (ALP) and osteocalcin (OC), was also measured by reverse transcription polymerase chain reaction (RT-PCR). ALP activity in the cell lysate was measured by use of the SenoLyte pNPP Alkaline Phosphatase Assay Kit (AnaSpec, San Jose, CA). Finally, OC secretion was analyzed. After removal of the medium, growth medium plus 10⫺8-mol/L 1,25(OH)2 vitamin D3 was added and incubated for 24 hours. OC secretion from the medium was quantified with the Gla-OC Competitive Enzyme Immunoassay Kit (TaKaRa, Shiga, Japan). Chondrogenic Induction A pellet culture was performed for 3-dimensional culture.13,14 About 2.5 ⫻ 105 cells in the 15-mL polypropylene tube were centrifuged at 2,000 rpm for 4 minutes to form a pellet and then treated with chondrogenic medium consisting of high-glucose Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA) with 10⫺7-mol/L dexamethasone, 50 ␮g/mL Lascorbic acid-2-phosphate (Sigma), 0.4-mmol/L L-proline (Sigma), 1% ITS⫹1 (Sigma), 10 ng/mL recombinant human transforming growth factor ␤3 (TGF-␤3) (R&D Systems, Minneapolis, MN), and 500 ng/mL recombinant human bone morphogenetic protein 6 (BMP-6) (R&D Systems). After 21 days, chondrogenic differentiation was assessed by staining with toluidine blue (Muto Pure Chemicals, Tokyo, Japan). Expression of chondrocyte-specific genes, namely type II collagen and sry-type high-mobility group box 9 (Sox9), was also measured by RT-PCR. Adipogenic Induction To induce adipogenic differentiation, cells were cultured for 3 weeks in an adipogenic medium consisting of low-growth Dulbecco’s modified Eagle’s medium (Sigma) with 1-␮mol/L dexamethasone, 0.5mmol/L 3-isobutyl-1-methylxanthine (Sigma), 10 ␮g/mL insulin (Sigma), 0.2-mmol/L indomethacin (Sigma), and 10% FBS (Pittenger et al14; Oe et al13). After 3 weeks, adipogenic differentiation was evaluated by the cellular accumulation of neutral lipid vacuoles that were stained with Oil-red O (Muto Pure Chemicals). Expression of adipocyte-specific genes, namely lipoprotein lipase and peroxisome proliferator–activated receptor ␥-2, was also measured by RTPCR. TOTAL RNA EXTRACTION AND RT-PCR

To detect messenger RNA (mRNA) levels of specific genes related to each differentiation event, differentiated and undifferentiated cells were harvested. Total RNA was extracted by use of the RNeasy Mini Kit

(Qiagen, Valencia, CA), according to the manufacturer’s instructions. From each sample, approximately 1 ␮g of total RNA was reverse transcribed with oligo (dT) primer, deoxyribonucleoside triphosphate, 10 ⫻ polymerase chain reaction buffer (PCR), magnesium chloride, ribonuclease inhibitor, and Mulv Reverse Transcriptase (all from Applied Biosystems, Branchburg, NJ). The converted complementary DNA samples were amplified by PCR by use of Taq Gold DNA polymerase (Applied Biosystems). In all RT-PCR assays, the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase was analyzed to monitor RNA loading. Primers used for amplification are listed in Table 2. STATISTICAL ANALYSIS

StatView-J software (version 4.5; SAS Institute, Cary, NC) was used for statistical analysis. To assess the differences between treated and control cells, the Mann-Whitney U test was performed. P ⬍ .05 was considered statistically significant.

Table 2. RT-PCR PRIMERS USED FOR DIFFERENTIATIONSPECIFIC GENE EXPRESSION ANALYSIS

Primer Sequences (5=-3=) (Sense/Antisense) Housekeeping gene GAPDH CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCACC Osteoblast-related genes ALP CCCAAAGGCTTCTTCTTG CTGGTAGTTGTTGTGAGC OC TCACACTCCTCGCCCTATTGG GGGCAAGGGGAAGAGGAAAGA Adipocyte-related genes PPAR TGGGTGAAACTCTGGGAGATTC CATGAGGCTTATTGTAGAGCTG LPL GAGATTTCTCTGTATGGCACC CTGCAAATGAGACACTTTCTC Chondrocyte-related genes Col II TCTGCAACATGCAGACTGGC GAAGCAGACAGGCCCTATGT Sox9 AACATGACCTATCCAAGCGC ACGATTCTCCATCATCCTCC

Product Size (Base Pairs) 593

357 371

380 276

517 143

Abbreviations: Col II, type II collagen; LPL, lipoprotein lipase; PPAR, peroxisome proliferator–activated receptor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. Hasegawa et al. Mandibular Hematoma Cells in Fractures. J Oral Maxillofac Surg 2012.

602

MANDIBULAR HEMATOMA CELLS IN FRACTURES

Results MORPHOLOGIC CHARACTERISTICS AND IMMUNOPHENOTYPES OF ADHERENT MHCS

In the primary culture, the adherent MHCs gave rise to colonies that first became visible around day 5 of culture as cells exhibiting a fibroblast-like spindle shape. MHCs formed colonies of fibroblast-like cells observed in BMSCs. The colony size grew quickly, and after 3 to 4 weeks, the cells merged and formed a subconfluent monolayer of fibroblast-like cells. For at least the first 8 passages, there was minimal decline in proliferative capacity (data not shown). The cell-surface antigen profile of adherent MHCs was analyzed and compared with that of BMSCs. Both MHCs were strongly positive for mesenchymal stem cell–related markers CD29, CD44, CD105, and CD166 but negative for hematopoietic markers CD14, CD34, CD45, and CD133. The cell-surface antigen profile of MHCs was essentially the same as that of BMSCs (Table 3). OSTEOGENIC, CHONDROGENIC, AND ADIPOGENIC POTENTIAL OF ADHERENT MHCS IN VITRO

After a 3-week incubation under osteogenic conditions, MHCs formed a mineralized matrix as evidenced by alizarin red S staining (Fig 1A). In contrast, no mineralized matrix was observed under undifferentiated conditions (Fig 1B). The level of ALP activity and OC secretion under osteogenic conditions was significantly higher than under undifferentiated conditions on day 21 (Fig 2). This osteogenic potential was further confirmed by RT-PCR analysis, showing the expressions of ALP and OC under osteogenic conditions after a 3-week culture (Fig 3A).

Table 3. FACS ANALYSIS OF MHCS AT END OF PASSAGE 1

Cell-surface markers

MHCs

BMSCs

CD14 CD29 CD34 CD44 CD45 CD105 CD133 CD166

1.79 ⫾ 2.44 99.82 ⫾ 0.20 1.89 ⫾ 1.13 98.87 ⫾ 2.33 0.89 ⫾ 0.35 98.06 ⫾ 3.20 0.91 ⫾ 0.53 83.12 ⫾ 13.52

0.87 ⫾ 0.19 99.87 ⫾ 0.12 0.81 ⫾ 0.10 99.82 ⫾ 0.20 1.37 ⫾ 0.75 99.32 ⫾ 1.00 0.91 ⫾ 0.22 75.64 ⫾ 17.87

NOTE. The subconfluent monolayer of fibroblastic cells was harvested and labeled with antibodies against indicated antigens, and it was analyzed with a FACSaria cytometer (BD Sciences). Positive expression rates (percent) are displayed as mean ⫾ standard deviation. Analysis was performed on samples from 5 donors. Hasegawa et al. Mandibular Hematoma Cells in Fractures. J Oral Maxillofac Surg 2012.

FIGURE 1. Osteogenic and differentiation capacities of MHCs on histologic sections. Alizarin red S staining was performed after 21 days’ incubation in osteogenic medium (Os⫹) (A) or undifferentiated medium (Os⫺) (B). BMSCs served as positive controls (C). Scale bar, 200 ␮m. Hasegawa et al. Mandibular Hematoma Cells in Fractures. J Oral Maxillofac Surg 2012.

After a 3-week incubation under chondrogenic conditions, the pellets from BMSCs were greater than 1 mm in diameter. In contrast, cell pellets grown from MHCs were only 0.3 to 0.5 mm in diameter and had

HASEGAWA ET AL

FIGURE 2. Osteogenic capacity of MHCs on bar chart showing significantly higher ALP activity (A) and osteocalcin (OC) secretion (B) in osteogenic medium (Os⫹) than in undifferentiated medium (Os⫺) after 21 days in culture (asterisk, P ⬍ .05 compared with value in control group; n ⫽ 9).

603 vated cell sorter (FACS) analysis showed that the adherent MHCs expressed classical mesenchymal stem cell marker proteins, namely CD29, CD44, CD105, and CD166, while lacking hematopoietic markers, namely CD14, CD34, CD45, and CD133. The proliferative potential, osteogenic potential, and adipogenic potential of MHCs were comparable to those of BMSCs. These results indicated that MHCs could be a local reservoir and source for osteogenic progenitors in the intramembranous healing process of mandibular fractures. This suggested that 1 possible mechanism for mandibular fracture healing was that various factors acted on the MHCs at different stages of healing and the MHCs then differentiated into osteoblasts at differ-

Hasegawa et al. Mandibular Hematoma Cells in Fractures. J Oral Maxillofac Surg 2012.

an immature fibroblastic tissue appearance for the duration of the study (data not shown). The expression of Sox9 mRNA in MHCs was confirmed by RTPCR after a 21-day induction (Fig 3B). However, the expression of type II collagen mRNA was not observed in MHCs in the chondrogenic condition and, by contrast, was highly expressed in BMSCs. The development of a cartilage matrix from cell pellets of MHCs was not shown clearly by toluidine blue staining, whereas that from cell pellets of BMSCs was strongly shown (Fig 4A,B). After a 3-week incubation under adipogenic conditions, MHCs showed the formation of neutral lipid vacuoles, visualized by staining with Oil-red O (Fig 4C). By contrast, in undifferentiated conditions, no Oil-red O–positive lipid vacuole was observed (Fig 4D). The RT-PCR analysis showed the expressions of lipoprotein lipase and peroxisome proliferator–activated receptor ␥2 under adipogenic conditions after a 3-week culture (Fig 3C). All 9 samples analyzed for differentiation assay equally showed osteogenic, adipogenic, and chondrogenic differentiation capacity.

Discussion We successfully showed for the first time that cells derived from mandibular fracture hematoma present at the mandibular fracture site had high osteogenic and adipogenic capacity in vitro. This osteogenic potential suggests that MHCs may play a significant and dynamic role in the healing of mandibular fractures. The primary culture of adherent MHCs showed the formation of colonies of fibroblast-like cells. Cell-surface markers analyzed by fluorescence-acti-

FIGURE 3. RT-PCR analysis of gene expression of ALP and osteocalcin (OC) (A), type II collagen (Col II) and Sox9 (B), and lipoprotein lipase (LPL) and peroxisome proliferator–activated receptor (PPAR) ␥2 (C) in the cells in differentiated medium (Os⫹, Ch⫹, and Ad⫹) or in undifferentiated medium (Os⫺, Ch⫺, and Ad⫺) on day 21. BMSCs served as positive controls. (GAPDH, glyceraldehyde 3-phosphate dehydrogenase.) Hasegawa et al. Mandibular Hematoma Cells in Fractures. J Oral Maxillofac Surg 2012.

604

MANDIBULAR HEMATOMA CELLS IN FRACTURES

FIGURE 4. Adipogenic and chondrogenic capacities of MHCs on histologic sections stained with toluidine blue after 21 days’ incubation in chondrogenic medium (Ch⫹) (A) and positive controls (B). (Figure 4 continued on next page.) Hasegawa et al. Mandibular Hematoma Cells in Fractures. J Oral Maxillofac Surg 2012.

ent stages in an autocrine and/or paracrine manner. Therefore MHCs may play a critical role in mandibular fracture healing. On the other hand, in this in vitro study, the chondrogenic potential of MHCs was inferior to that of BMSCs, although the expression of Sox9 mRNA in MHCs was confirmed by RT-PCR. In contrast, our previous study of long bone fracture hematoma had

shown the high chondrogenic potential of LBHCs, which was comparable to BMSCs.13 MHCs express similar cell-surface markers to LBHCs and BMSCs,13 and the inferior chondrogenesis in MHCs therefore seemed surprising. The growth factor TGF-␤3 has been shown to be an essential inducer of chondrogenesis in human mesenchymal stem/progenitor cells.15-17 However, intensive investigations have

605

HASEGAWA ET AL

FIGURE 4 (cont’d). Oil-red O staining was performed after 21 days’ incubation in adipogenic medium (Ad⫹) (C) or undifferentiated medium (Ad⫺) (D). (Figure 4 continued on next page.) Hasegawa et al. Mandibular Hematoma Cells in Fractures. J Oral Maxillofac Surg 2012.

shown that TGF-␤3 alone does not fully differentiate mesenchymal stem/progenitor cells into cartilage.18,19 Researchers have found that bone morphogenetic proteins can have a large positive effect on chondrogenesis in human mesenchymal stem/ progenitor cells.13,18-25 Sekiya et al19 reported that the addition of BMP-6 improved chondrogenic differentiation of human BMSCs. Hennig et al21 showed that the reduced chondrogenic potential of

human adipose tissue– derived stromal cells driven by TGF-␤3 was overcome by the addition of BMP-6. Similarly, our previous study showed that human LBHCs exhibited high chondrogenesis with this combination.13 Therefore the combination of TGF-␤3 and BMP-6 is a strong inducer for chondrogenic differentiation of mesenchymal stem/progenitor cells. However, the current results showed that the combination of TGF-␤3 and BMP-6 did not en-

606

MANDIBULAR HEMATOMA CELLS IN FRACTURES

FIGURE 4 (cont’d). E, Positive control. Scale bar, 50 ␮m in A and B and 200 ␮m in C, D, and E. Hasegawa et al. Mandibular Hematoma Cells in Fractures. J Oral Maxillofac Surg 2012.

hance the chondrogenesis of MHCs in vitro, suggesting that these MHCs may inherently have poor chondrogenic potential. The poor chondrogenesis of MHCs in this study raises the possibility that MHCs do not engage in cartilage formation, namely endochondral ossification, during the fracture healing process. Several investigators have reported cartilage formation during the normal healing of membranous bone,6-8 although these findings are controversial. Therefore we postulated that other cells such as BMSCs, periosteum-derived cells, muscle-derived cells, and circulating mesenchymal stem cells might contribute to the endochondral bone healing process.26-30 At a minimum, our findings suggest that mandibular fracture hematomas contain MHCs that could contribute to the intramembranous bone healing process of mandibular fractures but not to the endochondral bone healing process. In conclusion, we showed for the first time that MHCs have high osteogenic and adipogenic differential capacity in vitro, comparable to BMSCs. The role of the mandibular fracture hematoma could be as a presumptive local reservoir for osteogenic progenitors and contribute to intramembranous bone healing. Our findings may provide new insight into the mechanism of intramembranous bone healing in membranous bone fracture. Acknowledgments The authors acknowledge Ms Kyoko Tanaka and Ms Minako Nagata (Department of Orthopaedic Surgery, Kobe University Graduate School of Medicine) for their technical assistance.

References 1. Jee WSS: The skeletal tissues, in Weiss L (ed): Histology: Cell and Tissue Biology (ed 5). London, MacMillan, 1983, pp 211-254 2. Dalton WJ: Study of the healing process following operative interference with the continuity of the rat maxilla. J Dent Res 31:230, 1952 3. Radden BG, Fullmer HM: Morphological and histochemical studies of bone repair in the rat. Arch Oral Biol 14:1243, 1969 4. Bell WH, Levy BM: Revascularization and bone healing after posterior maxillary osteotomy. J Oral Surg 29:313, 1971 5. Alberius P, Johnell O: Repair of intra-membranous bone fractures and defects in rats. Immunolocalization of bone and cartilage proteins and proteoglycans. J Craniomaxillofac Surg 19:15, 1991 6. Girgis FG, Pritchard JJ: Experimental production of cartilage during the repair of fractures of the skull vault in rats. J Bone Joint Surg Br 40:274, 1958 7. Craft PD, Mani MM, Pazel J, Masters FW: Experimental study of healing in fractures of membranous bone. Plast Reconstr Surg 53:321, 1974 8. Granström G, Nilsson LP: Experimental mandibular fracture: Studies on bone repair and remodellation. Scand J Plast Reconstr Surg Hand Surg 21:159, 1987 9. Mizuno K, Mineo K, Tachibana T, et al: The osteogenetic potential of fracture haematoma. Subperiosteal and intramuscular transplantation of the haematoma. J Bone Joint Surg Br 72:822, 1990 10. Grundnes O, Reikeras O: The importance of the hematoma for fracture healing in rats. Acta Orthop Scand 64:340, 1993 11. Steinbrech DS, Mehrara BJ, Rowe NM, et al: Gene expression of TGF-beta, TGF-beta receptor, and extracellular matrix proteins during membranous bone healing in rats. Plast Reconstr Surg 105:2028, 2000 12. Canalis E, Economides AN, Gazzerro E: Bone morphogenetic proteins, their antagonists, and the skeleton. Endocr Rev 24: 218, 2003 13. Oe K, Miwa M, Sakai Y, et al: An in vitro study demonstrating that haematomas found at the site of human fractures contain progenitor cells with multilineage capacity. J Bone Joint Surg Br 89:133, 2007

HASEGAWA ET AL 14. Pittenger MF, Mackay AM, Beck SC, et al: Multilineage potential of adult human mesenchymal stem cells. Science 284:143, 1999 15. Mackay AM, Beck SC, Murphy JM, et al: Chondrogenic differentiation of cultured human mesenchymal stem cells from marrow. Tissue Eng 4:415, 1998 16. Barry F, Boynton RE, Liu B, Murphy JM: Chondrogenic differentiation of mesenchymal stem cells from bone marrow: Differentiation-dependent gene expression of matrix components. Exp Cell Res 268:189, 2001 17. Lee HS, Huang GT, Chiang H, et al: Multipotential mesenchymal stem cells from femoral bone marrow near the site of osteonecrosis. Stem Cells 21:190, 2003 18. Indrawattana N, Chen G, Tadokoro M, et al: Growth factor combination for chondrogenic induction from human mesenchymal stem cell. Biochem Biophys Res Commun 320:914, 2004 19. Sekiya I, Colter DC, Prockop DJ: BMP-6 enhances chondrogenesis in a subpopulation of human marrow stromal cells. Biochem Biophys Res Commun 284:411, 2001 20. Estes BT, Wu AW, Guilak F: Potent induction of chondrocytic differentiation of human adipose-derived adult stem cells by bone morphogenetic protein 6. Arthritis Rheum 54:1222, 2006 21. Hennig T, Lorenz H, Thiel A, et al: Reduced chondrogenic potential of adipose tissue derived stromal cells correlates with an altered TGFbeta receptor and BMP profile and is overcome by BMP-6. J Cell Physiol 211:682, 2007

607 22. Lee SY, Miwa M, Sakai Y, et al: In vitro multipotentiality and characterization of human unfractured traumatic hemarthrosisderived progenitor cells: A potential cell source for tissue repair. J Cell Physiol 210:561, 2007 23. Lee SY, Miwa M, Sakai Y, et al: Isolation and characterization of connective tissue progenitor cells derived from human fracture-induced hemarthrosis in vitro. J Orthop Res 26:190, 2008 24. Vidal MA, Robinson SO, Lopez MJ, et al: Comparison of chondrogenic potential in equine mesenchymal stromal cells derived from adipose tissue and bone marrow. Vet Surg 37:713, 2008 25. Iwakura T, Miwa M, Sakai Y, et al: Human hypertrophic nonunion tissue contains mesenchymal progenitor cells with multilineage capacity in vitro. J Orthop Res 27:208, 2009 26. Brighton CT, Hunt RM: Early histologic and ultrastructural changes in microvessels of periosteal callus. J Orthop Trauma 11:244, 1997 27. Kuznetsov SA, Mankani MH, Gronthos S, et al: Circulating skeletal stem cells. J Cell Biol 153:1133, 2001 28. Deasy BM, Li Y, Huard J: Tissue engineering with musclederived stem cells. Curr Opin Biotechnol 15:419, 2004 29. Eghbali-Fatourechi GZ, Lamsam J, Fraser D, et al: Circulating osteoblast-lineage cells in humans. N Engl J Med 352:1959, 2005 30. Sun JS, Wu SY, Lin FH: The role of muscle-derived stem cells in bone tissue engineering. Biomaterials 26:3953, 2005