1429_200800160_Kazaks.qxd
07.11.2008
14:20 Uhr
Biotechnol. J. 2008, 3, 1429–1436
Seite 1429
DOI 10.1002/biot.200800160
www.biotechnology-journal.com
Research Article
Melanoma vaccine candidates from chimeric hepatitis B core virus-like particles carrying a tumor-associated MAGE-3 epitope Andris Kazaks, Reinis Balmaks*, Tatyana Voronkova, Velta Ose and Paul Pumpens Latvian Biomedical Research and Study Center, Riga, Latvia
Vaccination of melanoma patients with tumor-specific antigens recognized by cytotoxic T lymphocytes (CTLs) may produce significant tumor regressions. Here, we suggest a novel type of tumor vaccines, with well-studied CTL epitopes presented on highly immunogenic virus-like particle (VLP) carriers. Cancer-germline gene MAGE-3 encodes for an antigenic nonapeptide (MAGE-3168–176 peptide) that is recognized by CTLs on human leukocyte antigen (HLA)-A1 and HLA-B35 molecules. A set of recombinant genes encoding hepatitis B virus core protein carrying MAGE-3 epitope was constructed and expressed in Escherichia coli cells. Variants that led to formation of chimeric VLPs in vivo were purified and analyzed for their DNA binding properties in vitro. VLPs exhibiting the most pronounced nucleic acid binding affinity were selected and loaded either with single-stranded DNA oligodeoxynucleotides rich in nonmethylated CG motifs, or with longer double-stranded DNA fragments. Packaged DNA was protected, at least partially, against the action of bacterial DNase. Such highly purified chimeric VLPs with entrapped immunomodulatory sequences could possibly be used as antitumor vaccines.
Received 30 July 2008 Revised 1 September 2008 Accepted 23 September 2008
Keywords: CpG packaging · Melanoma · Vaccines · Virus-like particles · Tumor antigens
1
Introduction
The discovery of tumor-specific antigens recognized in human tumors by autologous cytotoxic T lymphocytes (CTLs) has opened the possibility for the therapeutic vaccination of cancer patients. Tumor antigen-derived peptides, which are presented by MHC class I molecules at the cell surface, can be encoded by cancer-germline genes, mutated genes, differentiation genes or genes overexpressed in tumors (see http://www.cancerimmunity.org/peptidedatabase/Tcellepitopes.htm). Can-
Correspondence: Dr. Andris Kazaks, Latvian Biomedical Research and Study Center, Ratsupites 1, LV-1067 Riga, Latvia E-mail:
[email protected] Fax: +371-67442407 Abbreviations: aa, amino acid(s); CpG, nonmethylated CG motif; CTL, cytotoxic T lymphocyte; HBc, hepatitis B virus core protein; HBV, hepatitis B virus; HLA, human leukocyte antigen; MAGE, melanoma antigen-encoding gene; MIR, major immunodominant region; ODN, oligodeoxynucleotide; Ptrp, tryptophan operon promoter; VLP, virus-like particle; wt, wild-type
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
cer-germline genes are expressed in various tumors, but are silent in normal tissues, with the exception of male germline cells, which do not express MHC molecules and therefore do not present antigenic peptides to CTLs [1]. Therefore, products of these genes appearing on the surface of tumor cells might be considered as safe and specific targets for immunotherapy. The MAGE gene family is a prototype of the cancer-germline genes [2], expression of which in tumors appears to be triggered by a demethylation process [3]. Among them, the MAGE-A3 (or MAGE-3) gene is expressed in 74% of metastatic melanomas [4]. A nonapeptide, 168-EVDPIGHLY176 (MAGE-3168–176 peptide), is recognized by CTLs on HLA-A1 [5] and HLA-B35 [6] molecules, which are carried by about 26% and 20% of Caucasians, respectively [7]. Several small-scale clinical trials with HLA-A1-positive melanoma patients involving vaccination with the MAGE-3168–176 peptide
* Present address: Children’s University Hospital, LV-1004 Riga, Latvia
1429
1429_200800160_Kazaks.qxd
07.11.2008
14:20 Uhr
Seite 1430
Biotechnology Journal
have led to tumor regression in a minority of patients; however, it failed to induce massive CTL responses [8, 9]. Similarly, vaccination with recombinant canarypox virus encoding for MAGE-3168–176 and MAGE-1161–169 peptides both presented by HLA-A1 and B35 on tumor cells showed some evidence of tumor regression in 6 out of 30 melanoma patients [10]. Presentation of tumor antigen CTL epitope peptides on specific highly immunogenic carriers such as virus-like particles (VLPs) might exert a more intensive therapeutic effect. The VLP technique is based on the ability of viral structural proteins to self-assemble into highly organized symmetric structures, without the need for further viral components (for a review see [11]). Since VLPs lack viral genome, they are non-infectious. Purification of VLPs is relatively simple owing to their multimeric molecular organization. Due to their highly repetitive structure, VLPs are known to induce strong antibody responses in the absence of adjuvants [12]. In addition, VLPs are able to prime CTL responses in vivo (for a review see [11]). Genetically engineered HBc particles belong to the most promising and well-studied VLP carriers (for a review see [13, 14]). Hepatitis B virus (HBV) core protein (HBc) is known to induce strong B cell, T cell, and CTL responses in hepatitis B patients (for a review see [15]). It functions as both a T celldependent and T cell-independent antigen [16] and may provide inserted sequences with the same property [17]. After immunization with HBc VLPs, the latter prime preferentially Th1 cells, without any requirement for adjuvants [18]. However, CpG oligodeoxynucleotides (ODNs), the most promising adjuvants known to date [19, 20], greatly facilitate induction of peptide-specific CTL response after packaging into chimeric HBc VLPs [21]. Here, we present a possibility of incorporating the well-characterized MAGE-3168–176 epitope into HBc VLPs. We constructed a set of chimeric HBcMAGE proteins and selected those which met the following criteria: (i) high-level synthesis in E. coli, (ii) efficient self-assembly into VLPs, (iii) simple and convenient purification procedure, and (iv) strong nucleic acid packaging capacity in vitro. We propose that such chimeric HBc-MAGE VLPs carrying packaged CpGs represent potential tumor vaccine candidates.
Biotechnol. J. 2008, 3, 1429–1436
2 2.1
Materials and methods Plasmids
HBc gene from an HBV genome isolate, subtype ayw [22], was used as a basic template for all plasmid constructions. The HBc gene encoding a 183amino acid (aa) HBc protein has been originally cloned into plasmid pHBc3 [23] under control of the tryptophan operon promoter (Ptrp). Thereafter, the HBc gene along with the Ptrp was re-cloned into a pBR327-derived vector using HindIII and NruI restriction sites. Oligonucleotide duplexes encoding MAGE-3168–176 or MAGE-3163–181 peptides were cloned either into the major immunodominant region (MIR), or at the C terminus, using Eco91I/SnaBI or Pfl23II/BspTI restriction sites, respectively. Restriction endonucleases, other enzymes as well as protein and DNA molecular weight markers were purchased from Fermentas (Vilnius, Lithuania). PCR mutagenesis and cloning procedures were performed essentially as described in [24].
2.2
Expression of recombinant HBc-MAGE genes
Ptrp-directed expression of recombinant HBcMAGE genes was performed in E. coli strain BL21. To prepare an inoculum for cultivation, E. coli cells were transformed with expression plasmids, and individual colonies were incubated in LB medium overnight without shaking at 37ºC. For large-scale expression, inoculum was diluted 1:50 into M9 minimal medium supplemented with 1% casamino acids (Difco, Detroit, MI, USA) and 0.2% glucose.After growing on a rotary shaker at 37ºC for 16–20 h, cells were sedimented by low-speed centrifugation and stored at –20ºC until use. For SDS-PAGE of cell lysates, an equal amount of E. coli cells (2 optical units at A=590 nm) was suspended in 200 µL Laemmli’s sample buffer containing 2% SDS and 5% 2-mercaptoethanol and boiled at 100°C for 7 min. SDS-PAGE in 15% polyacrylamide gel was performed according to standard protocols. After separation, gels were stained with CBB G-250 (Sigma, Taufkirchen, Germany).
2.3
Purification of VLPs
E. coli cells (wet weight 1 g) were resuspended in 6 volumes of lysis buffer (50 mM Tris-HCl, pH 8, 150 mM NaCl, 5 mM EDTA), with addition of 1 mM PMSF (Sigma, Taufkirchen, Germany), and ultrasonicated five times for 15 s at 22 kHz. After centrifugation for 20 min at 10 000 × g, soluble proteins in the supernatant were precipitated with ammoni-
1430
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
1429_200800160_Kazaks.qxd
07.11.2008
14:20 Uhr
Seite 1431
Biotechnol. J. 2008, 3, 1429–1436
um sulfate at 33% of saturation for 1 h at 4ºC, followed by centrifugation for 30 min at 10 000 × g.The sediment was dissolved in 1 mL PBS and subjected to size-exclusion chromatography on a Sepharose CL-4B column. Peak protein fractions were pooled and VLPs were sedimented by ultracentrifugation (Beckman 70 Ti rotor, 200 000 × g, 1 h, 4ºC).The sediment was again dissolved in a minimal amount of PBS and loaded onto Superdex 200 10/300 GL gel filtration column connected to an AKTA chromatography system (Amersham Biosciences, Uppsala, Sweden). Finally, VLPs were concentrated with an Amicon filter device (Millipore, Cork, Ireland; molecular weight cut-off 100 kDa) according to manufacturer’s recommendations.
2.4
Electron microscopy
The purified chimeric VLPs were adsorbed on carbon-formvar-coated cooper grids and negatively stained with 1% uranyl acetate aqueous solution. The grids were examined with a JEM-100C electron microscope (JEOL Ltd., Tokyo, Japan) at an accelerating voltage of 80 kV.
2.5 Packaging of DNA into VLPs VLPs were loaded with CpG ODN 7909 5’– TCGTCGTTTTGTCGTTTTGTCGTT–3’ [25], synthesized by Metabion (Martinsried, Germany). Alternatively, 500- and 1000-bp dsDNA PCR fragments were gel-extracted from the 1-kb DNA ladder. DNA packaging into VLPs was performed by osmotic shock basically as described in [26], but with several modifications. Briefly, purified VLPs (20–25 µg) were mixed with 10 µg RNase A and 4 µg desired DNA probes (final volume 15 µL).The mixture was then diluted with distilled H2O (final volume 50 µL) and incubated for 1 h at 50°C. To analyze DNA protection, samples were treated with DNase I (1 U enzyme per 1 µg DNA) for 15 min at 37°C. VLPs were disrupted by addition of 1 volume of phenol solution (Sigma, Taufkirchen, Germany) in the presence of 0.5% SDS and vortexing for 1 min. Electrophoresis in 1% native agarose gels was performed in TAE buffer (pH 8.4) for about 0.5 h at 5 V/cm.
3
Results and discussion
www.biotechnology-journal.com
charged C-terminal nucleic acid-binding domain (aa 145–183) harboring four arginine-rich clusters. In fact, even 139–140-aa HBc molecules are self-assembly competent, but have limited stability and nucleic acid binding properties [27]. As carrier modules, we have chosen several C-terminally truncated HBc variants encoding 161-, 168-, and 176-aa HBc polypeptides. The latter contained 2, 3, and 4 arginine-rich clusters, respectively. This strategy was considered since the length of the C terminus plays an important role not only for nucleic acid binding, but also for the expression level and self-assembly efficiency of chimeric HBc molecules ([28], Kazaks, Sominskaya, unpublished observations). According to the X-ray structure data of the HBc VLPs [29], the MIR and the C terminus of the HBc protein are the regions most favored to accept foreign insertions.A number of experiments confirm that sequences inserted into the MIR are displayed on the surface of VLPs, while C-terminal inserts are likely to be situated internally [30–34]. To obtain a high-level B cell response, surface exposure of the insert is desirable (for a review see [11, 14]), while, in the case of T cell epitopes, an internal localization might also be possible or even advantageous. Therefore, we were interested in testing both sites for their capacity to accept insertion of a CTL epitope. Firstly, the nucleotide sequence of the HBc gene was modified to replace codons poorly translated in bacterial cells (without affecting the aa sequence) and facilitate further cloning procedures (Fig. 1a). Due to the surprisingly high aa homology of the MAGE-3168–176 epitope and the HBc stretch (aa 76–84) located at the MIR, direct substitution of the respective HBc sequence with the MAGE-3168–176 epitope has elicited a special interest (Fig. 1b). A minimal sterical hindrance was expected in the case of modification of the HBc MIR rather than in the case of addition of foreign insertions. Thus, the construct HBcMage161 (terminating at HBc aa 161) and two its analogues, HBcMage168, and HBcMage176 (terminating at HBc aa 168 and 176, respectively) were generated (Fig. 1b). For insertions into the more flexible HBc C terminus, we focused on the extended MAGE-3 epitope sequence (aa 163–181), which theoretically might facilitate its processing and presentation to HLA complexes in vivo [35, 36]. As in the case of MIR insertions, this led to generation of constructs named HBc161Mage, HBc168Mage, and HBc176Mage, respectively (Fig. 1c).
3.1 Design of constructs The wild-type (wt) HBc molecule is composed of two functionally distinct parts: an N-terminal selfassembly domain (aa 1–144) and a positively
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
1431
1429_200800160_Kazaks.qxd
07.11.2008
14:20 Uhr
Seite 1432
Biotechnology Journal
Biotechnol. J. 2008, 3, 1429–1436
Figure 1. Generation of recombinant HBc-MAGE genes. (a) Description of the wt HBc derivatives used as a template for constructions. Upper panel displays the structure of the HBc genes encoding for 161-, 168-, and 176-aa HBc molecules. In the nucleotide sequence, unique restriction sites used for cloning are underlined. Modified nucleotides are marked in bold. In the protein sequence, arginine-rich clusters are shown in bold, while C-terminal aa P161, S168, and S176 are boxed. HBc aa 76–84 in MIR are in italics. The lower panel provides a more general view on the respective HBc genes, with four arginine-rich clusters designated as “+”. (b) Schematic representation of the chimeric HBc-MAGE constructs generated by replacement of the MIR with the MAGE-3168–176 epitope. (c) Chimeric HBcMAGE constructs generated by insertion of the MAGE-3163–181 peptide into the C-terminal part of the HBc molecule.
3.2 Synthesis, purification, and characterization of chimeric HBc-MAGE VLPs The recombinant HBc-MAGE genes were expressed under control of Ptrp, ensuring low-speed accumulation of target protein. Expression level was monitored by SDS-PAGE. In all cases, chimeric HBc-MAGE proteins were easily detectable in CBB-stained polyacrylamide gels, where these proteins appeared as single bands at corresponding molecular weight distances (Fig. 2a). In general, accumulation of HBc-MAGE proteins was comparable with that of wt 161-aa HBc, with the exception of HBcMage176 for which the expression level was markedly lower (Fig. 2a). After sonication, electron microscopy revealed the presence of VLPs in all cell supernatants. However, chimeras with MIR insertions appeared highly unstable during salt precipitation. The appropriate VLPs disappeared after ammonium sulfate treatment (data not shown). In contrast, chimeric proteins with Cterminal insertions of the MAGE-3163–181 sequence exhibited higher levels of synthesis and concen-
1432
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
trated well with ammonium sulfate.Therefore, they were selected for further screening. At first glance, it might seem rather strange that substitution of several aa within the MIR leads to significant instability of VLPs, whereas insertions of 120 or even 240 aa into this region do not interfere with particle assembly [32, 33]. However, these long aa fragments were demonstrated to form complete functional domains per se, which could therefore be independently exposed on the surface of chimeric VLPs, without impeding capsid self-assembly. On the other hand, MIR insertions of short non-structured aa stretches have been shown to significantly affect the self-assembly of the HBc molecules [37]. Our experiments strongly suggest that the C terminus of the HBc molecule is the place of choice for insertion of such “problematic” sequences as CTL epitopes. Once the C-terminal constructs exhibited satisfactory expression level and stability of VLPs, we aimed to choose chimeras with the nucleic acid binding capacity suitable for DNA packaging purposes. It has been shown that during the assembly
1429_200800160_Kazaks.qxd
07.11.2008
14:20 Uhr
Seite 1433
Biotechnol. J. 2008, 3, 1429–1436
www.biotechnology-journal.com
Figure 2. Expression of recombinant HBc-MAGE genes and nucleic acid binding capacity of the respective VLPs. (a) CBB-stained polyacrylamide gel demonstrating synthesis of chimeric HBcMAGE proteins (marked by arrowheads). (-) negative control; (+) positive control, 161-aa wt HBc-expressing cells. Panels of chimeric MIRand C-terminal HBc-MAGE constructs are indicated. (b) Native agarose gels stained either with ethidium bromide (left), or with CBB (right) demonstrating the nucleic acid binding properties of C-terminal HBc-MAGE VLP chimeras. Lane 1, 1-kb DNA ladder. Lane 2, wt HBc161 VLPs in comparison with C-terminal HBc-MAGE VLP chimeras harboring HBc aa 161, 168, and 176 (lanes 3–5, respectively). Approximately 5 μg protein per track was loaded.
process in bacteria, nonspecific nucleic acid (preferentially RNA) is packaged inside the recombinant HBc VLPs [27]. Similarly, native HBV encapsidates pregenomic RNA, which is only later converted to DNA within the viral particle [38]. However, membrane-immobilized HBc binds DNA as well [39], indicating the possibility of packaging both RNA and DNA within recombinant VLPs. The nucleic acid binding capacity of VLPs can be easily monitored by native agarose gel electrophoresis [27]. The cell lysates derived from the C-terminal constructs were firstly subjected to a size-exclusion purification through Sepharose CL-4B beads. This step typically removes the majority of contaminating proteins and generally results in VLP purity of up to 80% [40, 41], which is enough to look for their nucleic acid binding properties. For that purpose, equal amounts of chimeric HBc-MAGE VLPs taken from the corresponding Sepharose column elution fractions were compared in native agarose gel stained with ethidium bromide (Fig. 2b, left panel). Surprisingly, despite the two arginine-rich clusters, HBc161Mage VLPs displayed no visible
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
nucleic acid binding activity, while its wt HBc analogue produced a strong and easily detectable band, with a mobility corresponding to the dsDNA 1500-bp molecular weight marker (lanes 1–3). The presence of three or four arginine-rich clusters led to increased signal and slightly diffuse bands migrating between the 1000- and 1500-bp dsDNA markers (lanes 4 and 5, respectively). The same amount of VLPs in agarose gel was stained in parallel with CBB to confirm that equal quantity of protein had been loaded per track (Fig. 2b, right panel). The results indicate a strong influence of the MAGE-3 sequence on the nucleic acid binding capacity of chimeric VLPs. One possible explanation might be ionic interaction of negatively charged MAGE-3 aa stretch with positively charged arginine repeats within the HBc C-terminal domain. Taken together, only the HBc176Mage VLPs, out of six constructs, showed stability and nucleic acid binding capacity comparable with those of wt HBc161 VLPs. Therefore, the HBc176Mage VLPs were chosen for the following packaging experiments.
1433
1429_200800160_Kazaks.qxd
07.11.2008
14:20 Uhr
Seite 1434
Biotechnology Journal
3.3 Packaging of DNA into chimeric VLPs VLPs alone are known to induce strong B cell response (for a review see [11-14]). However, an appropriate adjuvant is strongly recommended for efficient CTL response [19, 20]. In contrast, it has been demonstrated that CpGs are potent T cell inducers (for a review see [20]), but might exhibit several drawbacks when administrated alone [42]. Combination of these two strategies by packaging CpG ODNs into VLPs has induced protective CTL responses in the absence of systemic side effects in tumor mice [21]. Moreover, CpG ODNs together with melanoma antigen A peptide promoted strong antigen-specific CD8+ T cell responses in humans [25].Thus, incorporation of well-characterized CTL epitopes into VLPs followed by their loading with defined immunomodulatory sequences might become a common strategy for development of novel tumor vaccines. HBc176Mage VLPs obtained after first gel-filtration step were further purified as described in the Materials and methods. The final product displayed at least 90% of homogeneity as demonstrated by SDS-PAGE (Fig. 3a). Interestingly, even after boiling in Laemmli’s sample buffer, small amounts of dimers still remained on the gel, indicating the extremely strong interactions of chimeric HBc monomers. The quality of the VLPs was verified by electron microscopy (Fig. 3b). However, as can be seen in Fig. 2b, these VLPs still contained nonspe-
Biotechnol. J. 2008, 3, 1429–1436
cific nucleic acid that had to be removed before replacement with defined DNA sequences. We chose three DNA fragments of different length (24-nt ssDNA CpG ODN, and dsDNA of 500 and 1000 bp) to investigate their packaging efficiency and protection against DNase action. Since chimeric VLPs per se migrated in native agarose gel between 1000 and 1500 dsDNA bands, this was a convenient way for monitoring these processes. After incubation of VLPs with RNase alone, practically no nucleic acid signal was detectable, confirming that indeed the majority of VLP-associated nucleic acid is RNA (Fig. 3c, lanes 1, 2). In contrast, the same reaction in the presence of desired DNA probes resulted in visible VLP-corresponding bands, which might indicate replacement of nonspecific RNA with the target DNA (lanes 3–5). This assumption was confirmed by disruption of respective VLPs and running products in the same agarose gel (lanes 6–10), clearly indicating definite DNA bands in the samples used for packaging (lanes 8–10). Interestingly, in the case of the CpG probe, there was also a distinct non-VLP band apparently representing “free” CpG ODNs (lane 3), while longer DNA fragments remained completely associated with VLPs (lanes 4, 5). Based on these observations, the approximate amount of DNA per particle could be calculated; 1 µg chimeric protein corresponds to 1.1 × 1011 of VLPs, while 1 µg of 500and 1000-bp dsDNA contains 1.8 × 1012 and 0.9 × 1012 molecules, respectively. Accordingly, if
Figure 3. Packaging of DNA into the chimeric HBc176Mage VLPs. CBB-stained polyacrylamide gel (a) and electron microscopy (b) demonstrating the purity of VLPs used for packaging. (c) Association of nucleic acid with chimeric VLPs. Lane 1, control, non-treated VLPs. In parallel, VLPs were incubated either with RNase alone (lane 2), or in combination with CpGs (lane 3), 0.5 kb DNA (lane 4), or 1 kb DNA (lane 5). Products of these VLPs (lanes 1–5) after disruption are shown in lanes 6–10, respectively. (d) Protection of VLP-associated DNA. Lanes 1–5 represent the same products as in (c) but after DNase treatment and phenol disruption. As control, VLP-free DNA fragments used for packaging were treated with DNase under the same conditions (lanes 6–8), or loaded on gel without DNase treatment (lanes 9–11, respectively). M, 1-kb DNA ladder.
1434
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
1429_200800160_Kazaks.qxd
07.11.2008
14:20 Uhr
Seite 1435
Biotechnol. J. 2008, 3, 1429–1436
5–6 µg VLPs bind 1 µg DNA, that means association of at least two copies of 500-bp or one copy of 1000bp dsDNA molecules per particle. This indicates that the stoichiometry of DNA binding by chimeric VLPs corresponds, to a certain extent, to the natural capacity of genomic HBV RNA binding by the HBc cores. However, efficiency and reversibility of DNA and VLP interactions might be dependent on the size of DNA. To investigate protection of VLP-associated DNA versus “free” DNA, the VLPs after packaging were treated with DNase followed by phenol disruption. The results represented in Fig. 3d clearly demonstrate that VLP-associated DNA remains at least partially protected (lanes 3–5), while the same amount of “free” DNA was rapidly degraded in the same conditions (lanes 6–8). The very weak nucleic acid (RNA) signal in the control (compare lane 1 in Fig. 3d to lane 6 in Fig. 3c) suggests that under appropriate reaction conditions some nucleic acid might remain associated with non-soluble protein complexes, and the actual amount of protected DNA is even higher. Nevertheless, visually it seems that 1 kb DNA is more sensitive to DNase than shorter 0.5-kb DNA fragments. This might be explained by only partial packaging of longer DNA molecules, whereas shorter ones would be located more internally within VLPs. On the other hand, very short molecules, like ODNs, might not attach strongly enough to VLPs. However, it still remains to be elucidated whether in any given case DNA protection is a consequence of packaging or only association with VLPs. Similar experiments have been carried out also by other research groups. Thus, the binding of heterologous DNA to empty polyomavirus pseudocapsids was shown to protect DNA and allow its transfer to human cell lines in vitro [43]. The same goal might also be achieved by dis- and reassembly of VLPs in the presence of target DNA [44]. In another approach, the authors successfully used CpG ODNs with DNase-protected phosphorothioate bonds for packaging within chimeric HBc and bacteriophage Qβ-derived VLPs [21]. However, the synthesis of longer DNase-protected DNA fragments would be far too expensive for large-scale experiments. To achieve maximal protection and packaging efficiency, optimization of DNA length and reaction conditions might be necessary in each particular case.
4
Concluding remarks
In recent years, many attempts have been undertaken to construct effective tumor vaccines, unfor-
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.biotechnology-journal.com
tunately still with relatively little success. Among them, chimeric VLPs of different origin carrying foreign epitopes or polypeptides in certain locations in the carrier molecule have been suggested as promising vaccine candidates. In addition, VLPbased technologies have also been developed for gene packaging and transfer purposes (for a review see [14, 45]). It is likely that development of a novel generation of tumor vaccines will require a combination of both strategies. Here, we have provided chimeric HBc VLPs with inserted tumor-specific MAGE-3 epitope. Resulting chimeric VLPs can be successfully loaded with short-sized adjuvant DNA molecules, namely, CpG ODNs. The relative ease with which such high-molecular protein-DNA complexes can be produced, purified, and standardized, leads us to suggest them as potential candidates for development of a therapeutic melanoma vaccine.
The authors wish to thank L. Kovalevska, I. Akopjana, and G. Grinberga for technical assistance. This work was supported by the grant 04.1147 from the Latvian Council of Sciences, by the VPD1/ERAF/ CFLA/05/APK/2.5.1./000019/P grant, and by the European Social Fund. The authors have declared no conflict of interest.
5
References
[1] Haas, G. G. Jr., D’Cruz, O. J., De Bault, L. E., Distribution of human leukocyte antigen-ABC and -D/DR antigens in the unfixed human testis. Am. J. Reprod. Immunol. Microbiol. 1988, 18, 47–51. [2] Chomez, P., De Backer, O., Bertrand, M., De Plaen, E. et al., An overview of the MAGE gene family with the identification of all human members of the family. Cancer Res. 2001, 61, 5544–5551. [3] De Smet, C., De Backer, O., Faraoni, I., Lurquin, C. et al., The activation of human gene MAGE-1 in tumor cells is correlated with genome-wide demethylation. Proc. Natl. Acad. Sci. USA 1996, 93, 7149–7153. [4] Brasseur, F., Rimoldi, D., Lienard, D., Lethe, B. et al., Expression of MAGE genes in primary and metastatic cutaneous melanoma. Int. J. Cancer 1995, 63, 375–380. [5] Gaugler, B., van den Eynde, B., van der Bruggen, P., Romero, P. et al., Human gene MAGE-3 codes for an antigen recognized on a melanoma by autologous cytolytic T lymphocytes. J. Exp. Med. 1994, 179, 921–930. [6] Schultz, E. S., Zhang, Y., Knowles, R., Tine, J. et al., A MAGE3 peptide recognized on HLA-B35 and HLA-A1 by cytolytic T lymphocytes. Tissue Antigens 2001, 57, 103–109. [7] Marsh, S. G. E., Parham, P., Barber, L. D. (Eds.), The HLA Facts Book, Academic Press, San Diego 2000. [8] Marchand, M., van Baren, N.,Weynants, P., Brichard,V. et al., Tumor regressions observed in patients with metastatic melanoma treated with an antigenic peptide encoded by
1435
1429_200800160_Kazaks.qxd
07.11.2008
14:20 Uhr
Seite 1436
Biotechnology Journal
[9]
[10]
[11]
[12]
[13] [14]
[15] [16]
[17]
[18]
[19]
[20] [21]
[22]
[23]
[24]
[25]
[26]
1436
gene MAGE-3 and presented by HLA-A1. Int. J. Cancer 1999, 80, 219–230. Thurner, B., Haendle, I., Röder, C., Dieckmann, D. et al., Vaccination with mage-3A1 peptide-pulsed mature, monocytederived dendritic cells expands specific cytotoxic T cells and induces regression of some metastases in advanced stage IV melanoma. J. Exp. Med. 1999, 190, 1669–1678. van Baren, N., Bonnet, M. C., Dreno, B., Khammari, A. et al., Tumoral and immunologic response after vaccination of melanoma patients with an ALVAC virus encoding MAGE antigens recognized by T cells. J. Clin. Oncol. 2005, 23, 9008–9021. Pumpens, P., Grens, E., Artificial genes for chimeric viruslike particles, in: Khudyakov, Y. (Ed.), Artificial DNA: Methods and Applications, CRC Press, Boca Raton 2002, pp. 249–327. Bachmann, M. F., Rohrer, U. H., Kündig, T. M., Bürki, K. et al., The influence of antigen organization on B cell responsiveness. Science 1993, 262, 1448–1451. Pumpens, P., Grens, E., HBV core particles as a carrier for B cell/T cell epitopes. Intervirology 2001, 44, 98–114. Pumpens, P., Ulrich, R., Sasnauskas, K., Kazaks, A. et al., Construction of novel vaccines on the basis of the virus-like particles. Hepatitis B virus proteins as vaccine carriers, in: Khudyakov, Y. (Ed.), Medicinal Protein Engineering, CRC Press, Boca Raton 2008, pp. 205–248. Chisari, F.V., Ferrari, C., Hepatitis B virus immunopathogenesis. Annu. Rev. Immunol. 1995, 13, 29–60. Milich, D. R., McLachlan, A., The nucleocapsid of hepatitis B virus is both a T-cell-independent and a T-cell-dependent antigen. Science 1986, 234, 1398–1401. Fehr, T., Skrastina, D., Pumpens, P., Zinkernagel, R. M., T cell-independent type I antibody response against B cell epitopes expressed repetitively on recombinant virus particles. Proc. Natl. Acad. Sci. USA 1998, 95, 9477–9481. Milich, D. R., Schödel, F., Hughes, J. L., Jones, J. E. Peterson, D. L., The hepatitis B virus core and e antigens elicit different Th cell subsets: Antigen structure can affect Th cell phenotype. J. Virol. 1997, 71, 2192–2201. Kline, J. N., Krieg, A. M., CpG oligodeoxynucleotides, in: Hansel,T.T., Barnes, P.J. (Eds.), New Drugs for Asthma, Allergy and COPD, Progress in Respiratory Research, vol. 31, Basel, Karger 2001, pp. 229–232. Krieg,A. M.,Therapeutic potential of Toll-like receptor 9 activation. Nat. Rev. Drug Discov. 2006, 5, 471–484. Storni, T., Ruedl, C., Schwarz, K., Schwendener, R. A. et al., Nonmethylated CG motifs packaged into virus-like particles induce protective cytotoxic T cell responses in the absence of systemic side effects. J. Immunol. 2004, 172, 1777–1785. Bichko,V., Pushko, P., Dreilina, D., Pumpen, P. Gren, E., Subtype ayw variant of hepatitis B virus. DNA primary structure analysis. FEBS Lett. 1985, 185, 208–212. Borisova, G. P., Pumpen, P. P., Bychko, V. V., Pushko, P. M. et al., Structure and expression in Escherichia coli cells of the core antigen gene of the human hepatitis B virus (HBV). Dokl. Akad. Nauk SSSR (in Russian) 1984, 279, 1245–1249. Sambrook, J., Fritsch, E. F., Maniatis, T. (Eds.), Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989. Speiser, D. E., Lienard, D., Rufer, N., Rubio-Godoy, V. et al., Rapid and strong human CD8+ T cell responses to vaccination with peptide, IFA, and CpG oligodeoxynucleotide 7909. J. Clin. Invest. 2005, 115, 739–746. Barr, S. M., Keck, K., Aposhian, H. V., Cell-free assembly of a polyoma-like particle from empty capsids and DNA. Virology 1979, 96, 656–659.
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Biotechnol. J. 2008, 3, 1429–1436
[27] Birnbaum, F., Nassal, M., Hepatitis B virus nucleocapsid assembly: Primary structure requirements in the core protein. J. Virol. 1990, 64, 3319–3330. [28] Zlotnick, A., Cheng, N., Stahl, S. J., Conway, J. F. et al., Localization of the C terminus of the assembly domain of hepatitis B virus capsid protein: Implications for morphogenesis and organization of encapsidated RNA. Proc. Natl. Acad. Sci. USA 1997, 94, 9556–9561. [29] Wynne, S. A., Crowther, R. A., Leslie, A. G. W., The crystal structure of the human hepatitis B virus capsid. Mol. Cell 1999, 3, 771–780. [30] Schödel, F., Moriarty, A. M., Peterson, D. L., Zheng, J.A. et al., The position of heterologous epitopes inserted in hepatitis B virus core particles determines their immunogenicity. J. Virol. 1992, 66, 106–114. [31] Borisova, G., Arya, B., Dislers, A., Borschukova, O. et al., Hybrid hepatitis B virus nucleocapsid bearing an immunodominant region from hepatitis B virus surface antigen. J. Virol. 1993, 67, 3696–3701. [32] Kratz, P., Böttcher, B., Nassal, M., Native display of complete foreign domains on the surface of hepatitis B virus capsids. Proc. Natl. Acad. Sci. USA 1999, 96, 1915–1920. [33] Koletzki, D., Biel, S. S., Meisel, H., Nugel, E. et al., HBV core particles allow the insertion and surface exposure of the entire potentially protective region of Puumala hantavirus nucleocapsid protein. Biol. Chem. 1999, 380, 325–333. [34] Beterams, G., Böttcher, B., Nassal, M., Packaging of up to 240 subunits of a 17-kDa nuclease into the interior of recombinant hepatitis B virus capsids. FEBS Lett. 2000, 481, 169–176. [35] Bergmann, C. C., Yao, Q., Ho, C. K., Buckwold, S. L., Flanking residues alter antigenicity and immunogenicity of multiunit CTL epitopes. J. Immunol. 1996, 157, 3242–3249. [36] Mylin, L. M., Context-dependent immunogenicity of an S206G-substituted H-2Db-restricted simian virus 40 large T antigen epitope I variant. J. Immunol. 1999, 162, 2171–2179. [37] Karpenko, L. I., Ivanisenko, V. A., Pika, I. A., Chikaev, N. A. et al., Insertion of foreign epitopes in HBcAg: How to make the chimeric particle assemble. Amino Acids 2000, 18, 329–337. [38] Summers, J., Mason, W. S., Replication of the genome of a hepatitis B-like virus by reverse transcription of an RNA intermediate. Cell 1982, 29, 403–415. [39] Hatton, T., Zhou, S., Standring, D. N., RNA- and DNA-binding activities in hepatitis B virus capsid protein: A model for their roles in viral replication. J. Virol. 1992, 66, 5232–5241. [40] Borisova, G., Borschukova, O., Skrastina, D., Dislers, A. et al., Behavior of a short preS1 epitope on the surface of hepatitis B core particles. Biol. Chem. 1999, 380, 315–324. [41] Kazaks, A., Borisova, G., Cvetkova, S., Kovalevska, L. et al., Mosaic hepatitis B core particles presenting complete preS sequence of viral envelope on their surface. J. Gen. Virol. 2004, 85, 2665–2670. [42] Sparwasser, T., Hultner, L., Koch, E. S., Luz, A. et al., Immunostimulatory CpG-oligodeoxynucleotides cause extramedullary murine hemopoiesis. J. Immunol. 1999, 162, 2368–2374. [43] Forstova, J., Krauzewicz, N., Sandig, V., Elliott, J. et al., Polyoma virus pseudocapsids as efficient carriers of heterologous DNA into mammalian cells. Hum. Gene Ther. 1995, 6, 297–306. [44] Voronkova, T., Kazaks, A., Ose, V., Özel, M. et al., Hamster polyomavirus-derived virus-like particles are able to transfer in vitro encapsidated plasmid DNA to mammalian cells. Virus Genes 2007, 34, 303–314. [45] Kazaks, A.,Voronkova, T., Papillomavirus-derived virus-like particles, in: Khudyakov, Y. (Ed.), Medicinal Protein Engineering, CRC Press, Boca Raton 2008, pp. 277–297.
