Mitochondrial DNA sequence divergence in weevils of the Pissodes strobi species complex (Coleoptera: Curculionidae)

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/13948823

Langor, D. W. and Sperling, F. A. H.. Mitochondrial DNA sequence divergence in weevils of the Pissodes stobi species complex (Coleoptera: Curculionidae). Insect Mol Biol, 6: 255-26... ARTICLE in INSECT MOLECULAR BIOLOGY · SEPTEMBER 1997 Impact Factor: 2.59 · DOI: 10.1046/j.1365-2583.1997.00180.x · Source: PubMed

CITATIONS

READS

49

26

2 AUTHORS: David Langor

Felix A H Sperling

Natural Resources Canada

University of Alberta

121 PUBLICATIONS 2,338 CITATIONS

152 PUBLICATIONS 4,050 CITATIONS

SEE PROFILE

All in-text references underlined in blue are linked to publications on ResearchGate, letting you access and read them immediately.

SEE PROFILE

Available from: Felix A H Sperling Retrieved on: 04 February 2016

AID=IMB180

ARTTY=OA

Insect Molecular Biology (1997) 6(3), 255±265

Mitochondrial DNA sequence divergence in weevils of the Pissodes strobi species complex (Coleoptera: Curculionidae)

D. W. Langor1 and F. A. H. Sperling2 1

Canadian Forest Service, Northern Forestry Center, Edmonton, Alberta, Canada, and 2 Department of Environmental Science, Policy, and Management, University of California-Berkeley, California, USA

cladograms based on mtDNA sequence di€er from those based on earlier work. Keywords: Pissodes, mitochondrial DNA, sequence divergence, phylogeny.

Abstract

Introduction

Mitochondrial DNA sequence divergence is unusually high between several species of the Pissodes strobi complex, in contrast to low allozyme and morphological divergences, and the ability to hybridize in the laboratory. We sequenced an 810 bp segment in seven individuals, representing four species in the P. strobi complex and one outgroup species, P. anis Randall. The 810 bp segment covered the 3' half of the cytochrome oxidase subunit I (COI) gene. We also sequenced one specimen of P. strobi (Peck) over a 2301 bp region of mtDNA, extending from the 5' end of COI to the 3' end of COII. Uncorrected sequence divergences were below 1.1% among three specimens of P. schwarzi Hopkins, and between P. terminalis Hopping and P. nemorensis Germar. All other interspeci®c combinations in the P. strobi complex showed divergences of 6.0±7.5%. The outgroup species, P. anis, had an average divergence of 12.8% from members of the P. strobi group. As in most other insects, A+T content in Pissodes mtDNA was high; transition:transversion ratio was high among lineages exhibiting low divergences, but declined with increasing sequence divergence; and inferred amino acid sequence divergences were low. The degree of sequence divergence di€ers markedly across di€erent functional regions of the COI gene. The high mtDNA divergences within the P. strobi complex calculated from direct sequencing support earlier reports based on restriction site surveys; however,

The Pissodes strobi species complex contains four species that are common and important pests of Pinus and Picea in North America (Langor & Sperling, 1995). These are the white pine weevil, P. strobi (Peck), the lodgepole terminal weevil, P. terminalis Hopping, the deodar weevil, P. nemorensis Germar, and P. schwarzi Hopkins. These species are similar in morphology (Hopkins, 1911; Langor, unpublished data) and in allozyme characteristics (Phillips, 1984), but are cytogenetically distinct (Smith & Virkki, 1978). All species combinations have been successfully hybridized in laboratory cross-breeding experiments, resulting in fertile o€spring (Godwin & Odell, 1967; Smith & Takenouchi, 1969). Thus there is no signi®cant post-mating barrier to gene ¯ow among these species. Furthermore, the geographic ranges of all species overlap, with the possible exception of P. schwarzi and P. nemorensis (Langor & Sperling, 1995), and up to three species have been found in the same stand (e.g. see locality `h' in Langor & Sperling [1995]). Therefore, unless there is a rigid behavioural barrier to prevent interspeci®c mating, a scenario involving natural hybridization of some or all species in the P. strobi complex is plausible. There is evidence that natural hybridization of P. strobi and P. nemorensis occurs, based on cytogenetic data (Smith, 1962), mitochondrial DNA (mtDNA) (Boyce et al., 1994) and morphology (Langor, unpublished data). Furthermore, on the basis of cytogenetic data, Smith & Takenouchi (1962) have postulated that P. terminalis is a hybrid species formed from mixing of P. schwarzi and P. strobi genomes. Thus, these four species may be characterized as

Received 12 December 1996; accepted 11 March 1997. Correspondence: Dr David W. Langor, Canadian Forest Service, Northern Forestry Center, 5320-122 Street, Edmonton, Alberta, T6H 3S5, Canada.

# 1997 Blackwell Science Ltd

255

256

D. W. Langor and F. A. H. Sperling

sibling taxa that may still exchange genetic material, i.e. a species complex. Species complexes that show low morphological and biochemical di€erentiation and evidence of natural hybridization generally also exhibit low interspeci®c mtDNA sequence divergences (e.g. Sperling & Hickey, 1994; Harrison & Bogdanowicz, 1995; Sperling et al., 1995, 1996, 1997; Sperling, unpublished data); however, this is not the case with all members of the P. strobi species complex. Assessment of variation over the entire mtDNA genome using restriction fragment length polymorphism (RFLP) suggested very high genetic divergence among some species within the complex, ranging from 2% to 16% (Boyce et al., 1994). Later, Langor & Sperling (1995) estimated 0±12.4% sequence divergence among species of this complex based on RFLP analysis of a 1585 bp segment of mtDNA. However, it is expected that Pissodes sequence divergence estimates based on RFLP data may be exaggerated somewhat due to biased selection of restriction enzymes (Langor & Sperling, 1995). Therefore, since the high estimated sequence divergences among most species in the P. strobi complex contrasts with patterns observed for other insect complexes, it is important to verify this pattern. In this study we sought to obtain better estimates of divergence by sequencing a 810 bp segment covering the 3' end of the COI gene for each species in the P. strobi complex. This segment is included in the 1585 bp segment subjected to RFLP analysis by Langor & Sperling (1995). Sequence divergence is then compared to homologous sequence for other insect species complexes which hybridize and for which allozyme data are available as an independent measure of genetic divergence. A more distantly related species, P. anis Randall, was also sequenced to serve as an outgroup for reconstructing relationships among species within the P. strobi complex. A larger 2.3 kb segment of mtDNA covering the entire cytochrome oxidase subunit I (COI), tRNA leucine, and cytochrome oxidase subunit II (COII) genes was sequenced for one specimen of P. strobi. This represents the ®rst beetle for which the entire COI sequence has been obtained.

Results

DNA structure and variability Nucleotide substitutions among Pissodes sequences were found at 146 sites scattered across the entire 810 bp downstream half of COI (Fig. 1), and represented 18.0% of all sites. Of the variable sites, 127 occurred in the third-base position of codons, ®fteen in the ®rst,

and four in the second. Overall, eleven substitutions were non-synonymous. The 810 bp segment spans thirteen of the twenty-®ve regions of the COI gene, as described by Lunt et al. (1996), including four structural classes [six transmembrane helices (M7±M12), three external loops (E4±E6), three internal loops (I3±I5), and the carboxy terminal (COOH)], as shown in Fig. 1. Mean nucleotide and amino acid variability (Lunt et al., 1996) di€ers across regions (Fig. 2). Nucleotide variability was highest in I4, I5 and E6. Amino acid variability was highest in I4 and I5, followed by COOH and M12. Nucleotide frequencies over the 810 bp segment showed a strong A+T bias ranging from 66% to 70% among taxa. The biases were much stronger for thirdbase positions (77±87%) than for ®rst- (58±60%) and second-base positions (63%). The nucleotide proportions over the 2.3 kb region sequenced for P. strobi (Fig. 1) were 33.0% A, 36.4% T, 17.4% C, and 13.2% G. A+T content was higher for COII (73%) than for COI (68%).

Sequence and protein divergence Uncorrected sequence divergence was 0.2±1.1% within P. schwarzi, 0.5±7.5% among species of the P. strobi complex, and 11.9±13.8% between P. anis and the P. strobi complex (Table 1). Pissodes terminalis and P. nemorensis were the least divergent species (0.5%). In general, the proportion of substitutions represented by transversions increased with increasing sequence divergence (Table 1). An interesting exception occurred within P. schwarzi where transversions accounted for over 44% of substitutions for comparisons involving specimen 585. Sequence divergences corrected with a formula which takes into account strong biases in A+T content and transition:transversion ratio (Tamura, 1992a) were much higher than most uncorrected divergences. For interspeci®c comparisons of mtDNA lineages within the P. strobi complex (i.e. observed overall divergences of 6.0±7.5%), observed substitutions at the third-base positions accounted for only 60±75% of those that may have actually occurred. For all comparisons involving P. anis (i.e. observed overall divergences of 11.9±13.8%), observed substitutions represented only 33±50% of estimated third-base substitutions. There was variation in amino acids at nine locations (Table 2). There was no protein divergence detected between P. terminalis and P. nemorensis, and generally very little divergence among species within the P. strobi complex; however, 2±3% of amino acids varied between P. anis and members of the P. strobi complex. The 810 bp region sequenced coincides with a larger region for which RFLP data were earlier obtained # 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

Figure 1. The 2.3 kb sequence for P. strobi across the mitochondrial COI, COII and tRNA leucine genes, and alignment of the 810 bp sequence extending from the middle to the downstream end of the COI gene for five species and seven specimens of Pissodes. Numbering corresponds to homologous sequence in Drosophila yakuba (Clary & Wolstenholme, 1985). The sequence for tRNA leucine is underlined. Non-synonymous substitution sites are marked with an asterisk. The structural regions of the insect COI gene (see Lunt et al., 1996) are indicated below the sequence blocks (see text and Fig. 2 for details).

Pissodes mtDNA sequence divergence

# 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

257

D. W. Langor and F. A. H. Sperling

Figure 1 (continued).

258

# 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

Pissodes mtDNA sequence divergence

259

Figure 2. Mean nucleotide and amino acid variability for the thirteen structural regions (Lunt et al., 1996) of the insect COI gene spanned by the 810 bp sequence (Fig. 1). Variability was calculated as the average number of nucleotides per position and average number of amino acids per site over all seven sequences observed in each region.

Table 1. Uncorrected mtDNA sequence divergence or p-distance (above diagonal) and proportion of substitutions represented by transversions (under diagonal) for a 810 bp segment in seven specimens (®ve species) of Pissodes. Species 1. schwarzi 112 2. schwarzi 484 3. schwarzi 585 4. terminalis 5. nemorensis 6. strobi 7. anis

1

2

3

4

5

6

7

7 0.000 0.444 0.137 0.142 0.131 0.313

0.002 7 0.444 0.137 0.143 0.131 0.313

0.011 0.011 7 0.164 0.170 0.169 0.323

0.063 0.063 0.068 7 0.000 0.091 0.297

0.060 0.060 0.065 0.005 7 0.088 0.286

0.075 0.075 0.073 0.068 0.070 7 0.241

0.122 0.122 0.119 0.125 0.130 0.138 7

Table 2. Amino acid variation among ®ve species of Pissodes within a 810 bp segment of mtDNA. Vertical numbers at tops of columns refer to the position of the second nucleotide in codons showing nonsynonymous substitution.

Species

2 4 5 9

2 4 7 7

2 6 4 8

2 6 7 5

2 6 7 8

2 8 2 5

2 9 2 1

2 9 3 3

2 9 9 9

schwarzi terminalis±nemorensis strobi anis

Q Q Q E

P P S P

V T V V

L L L M

T V V T

A A V A

S S S A

A A A P

M M M L

(Langor & Sperling, 1995). All of the restriction sites identi®ed in the earlier study were con®rmed by the sequence data.

monophyly of P. schwarzi lineages, 100% support for the monophyly of P. terminalis and P. nemorensis, and 75% support for the monophyly of P. terminalis, P. nemorensis and P. strobi. A re-analysis of phylogenetic relationships using only transversions yielded three equally parsimonious trees of thirty-eight steps. The consistency index of these trees was 0.97. All three trees supported the monophyly of P. nemorensis and P. terminalis. One tree was identical to Fig. 3, one showed P. strobi as the sister group of P. schwarzi, and one showed P. schwarzi as the sister group to the nemorensis±terminalis clade. The latter tree was identical to the strict consensus tree. The monophyly of P. schwarzi was supported by 87% of bootstrap replicates, and that of the nemorensis±terminalis clade received 76% support.

Phylogenetic relationships A single most parsimonious tree of 178 steps (Fig. 3) was obtained from an exhaustive search of the seven mtDNA lineages using PAUP 3.1. The consistency index for this tree was 0.77, excluding uninformative characters. There was 99% bootstrap support for the # 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

Discussion

DNA structure and variability Intragenic variability in evolutionary rate has not received much attention, particularly in lower level

260

D. W. Langor and F. A. H. Sperling

Figure 3. Cladogram based on the 810 bp COI sequence for five species of Pissodes. Numbers and single bars on branches refer to the number of apomorphies. Percentages refer to the extent of support for lineages based on 500 bootstrap runs; only branches supported by 550% are indicated. Pissodes affinis was used as the outgroup.

phylogenetic studies (Lunt et al., 1996). Obviously, adjacent regions within the downstream half of the COI gene evolve at di€erent rates in Pissodes. The good correspondence of regions of high and low variability in Pissodes (Fig. 2) to the patterns reported for Diptera, Hymenoptera and Orthoptera (Lunt et al. 1996) indicates that relative evolutionary rates among regions of COI have remained similar throughout much of the evolutionary history of the Insecta. The A+T content of the 810 bp downstream segment of COI in Pissodes (66±70%) is lower than the 71±78% reported for four other orders of insects over the same segment (Clary & Wolstenholme, 1985; Crozier et al., 1989; Sperling & Hickey, 1994; Sperling et al., 1994, 1995, 1996, 1997). Similarly, the A+T content for P. strobi over the entire COI gene is 68%, which is at the low end of the 68±76% range reported for other insects (reviewed by Lunt et al., 1996). However, A+T content for the entire COII gene of P. strobi is 73%, which falls within the 70±82% range reported for other holometabolous insects (Clary & Wolstenholme, 1985; Crozier et al., 1989; Liu & Beckenbach, 1992; Sperling & Hickey, 1994), and is higher than the 67±72% reported for hemimetabolous insects (Liu & Beckenbach, 1992). The decline in transition:transversion ratios with increasing divergence indicates that initial bias towards transitions is extremely high. This pattern is similar to that reported for Choristoneura (Sperling & Hickey, 1994) and Drosophila (DeSalle et al., 1987; Tamura, 1992b; Beckenbach et al., 1993), and possible explanations are discussed elsewhere (Brown et al., 1982; DeSalle et al., 1987). Of the 146 variable sites, 110 di€er by transitions, twenty-®ve by transversions, and eleven by both. Of the twenty-®ve sites having only transversion di€erences, sixteen are A$T, six are A$C, and three are G$C. A similar excess of A$T transversions have been reported for Drosophila (DeSalle et al., 1987; Tamura, 1992b; Beckenbach et al., 1993).

Sequence and protein divergence The mtDNA of Pissodes is unusual in that it is relatively large (30±36 kb), exhibits a high degree of heteroplasmy, and has high inter- and intra-speci®c sequence divergences (Boyce et al., 1989, 1994; Langor & Sperling, 1995). Intra-speci®c sequence divergences for Pissodes, estimated by RFLP analysis of the downstream half of COI and all of COII (Langor & Sperling, 1995) were 1.3±2.8 times higher than those inferred from sequence data for the downstream half of COI. Some of this di€erence may be attributable to the absence of sequence divergence data for COII. Nonetheless, divergences based on RFLP data were clearly overestimated due to choice of endonucleases, which was biased towards those that showed restriction site di€erences between species in a preliminary survey of many enzymes. Nonetheless, the overall patterns of inter-speci®c divergence within the genus are similar, whether based on RFLP or sequence data. The inter-speci®c sequence divergences reported by Boyce et al. (1994), based on RFLP data from the entire mtDNA genome, ranged from 2% to 17% within the P. strobi complex and from 27% and 34% in comparisons involving P. anis. These divergences are much higher than those observed in this study, suggesting that the COI region is more conserved than other regions included in the earlier study. Langor & Sperling (1995) arrived at the same conclusion based on RFLP data collected from the COI and COII genes. Inter-speci®c sequence divergences for Pissodes are much higher than those reported for most other closely related, non-parthenogenetic insect species (e.g., Martin & Simon, 1990; Brower & Boyce, 1991; Willis et al., 1992; Beckenbach et al., 1993; Sperling, 1993a, b; Vogler et al., 1993; Brower, 1994; Sperling & Harrison, 1994; Sperling & Hickey, 1994, 1995; Harrison & Bogdanowicz, 1995; Sperling et al., 1995). However, # 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

Pissodes mtDNA sequence divergence

261

Figure 4. Scatter plot showing the correlation between mean uncorrected percent mtDNA sequence divergence for the downstream half of COI and mean Nei's allozyme distance for inter-specific comparison within six insect species complexes. The species included in each complex and distance measures utilized are listed in Table 3.

in Greya moths estimated sequence divergences (corrected for multiple substitutions) were as high as 16% between some species, and was 5.7% between two haplotypes of one species (Brown et al., 1994). Also, exceptionally high intra-speci®c COI divergences were reported for Ophraella beetles (3.8%; Funk et al. 1995a, b) and for the weevil, Hypera postica (Gyllenhal) (3.1%; Erney et al. 1996). However, caution is advocated in comparisons among studies because of little consistency in portions of the mtDNA genome studied, assessment methods used (RFLP or sequencing), and the degree of relatedness of clades examined. To more rigorously evaluate Pissodes sequence divergences, we compare them to ®ve other insect species groups that (1) have homologous mtDNA sequence data available; (2) are closely inter-related, as indicated by high morphological similarity and ability to hybridize; and (3) have allozyme data available as an independent measure of genetic (nuclear) divergence. Although allozyme studies did not all sample the same loci, some consistency is provided by the large number of loci sampled in each study (nine to ®fty-one). Intra-speci®c sequence divergences and allozyme distance measurements for Pissodes fell within the range of those reported for other species complexes (Table 3). Inter-speci®c sequence divergences within species complexes were at least twice as high for Pissodes as for any other genus; however, inter-speci®c allozyme distances for Pissodes fell well within the range of those of other complexes (Table 3, Fig. 4). Inter-speci®c sequence divergences comparing the outgroup taxon to congeners within the # 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

complex were highest for Pissodes, but only slightly higher than those for Anopheles. Similarly-compared allozyme distances were lowest for Pissodes (Table 3). The contrast between high sequence divergences and low allozyme (Phillips, 1984) and morphological (Hopkins, 1911; Langor, unpublished) variation suggests that the mitochondrial and nuclear genomes evolve at greatly di€erent rates. The high inter-speci®c sequence divergence within the P. strobi complex may indicate that this clade is much older than the other species complexes included in the comparison. Based on studies of insect mtDNA, Brower (1994) suggested that the molecular clock can be calibrated to 2% divergence per million years. If this is true for Pissodes, the P. strobi clade may be three to four million years old, whereas the other species complexes studied are all less than two million years old. Alternatively, the mtDNA genome of Pissodes may evolve at a much faster rate than other insect groups studied to date. Boyce et al. (1994) favoured the latter hypothesis based on observations of extensive polymorphism for restriction sites and size in Pissodes mtDNA. The relatively low allozyme and morphological divergences in the P. strobi complex further support this contention. Interestingly, the only other weevil genus for which sequence data are available also exhibited unusually high mtDNA sequence divergence. Inter-speci®c sequence divergences were 1±9% among haplotypes within the Aramigus tessellatus complex, but the most divergent taxa within the complex were parthenogenetic (Normark, 1996).

262

D. W. Langor and F. A. H. Sperling

Table 3. Intra- and inter-speci®c sequence divergences over the downstream half of the COI gene, distance measurements for allozyme data, and capability of cross-breeding for six species complexes of insects. Species complex1,2

Mean [range] sequence divergence

Mean [range] allozyme distance3

0.008 [0.002±0.011] (Pw) 0.057 [0.005±0.075]

0.020 [0.006±0.062] (Pn, Ps) 0.102 [0.004±0.214] (excl.Pw)

0.129 [0.119±0.138] See Table 3

0.324 [0.247±0.387] Phillips, 1984

Anopheles (Diptera: Culicidae) Intra-speci®c comparisons Inter-speci®c comparisons Complex to out group References

0.005 [0.004±0.007] (Ag, Am) 0.015 [0.007±0.024] (excluding Ab) 0.112 [0.110±0.116] Sperling, unpublished

Not available 0.268 [0.071±0.541] Not available Miles, 1978

Choristoneura (Lepidoptera: Tortricidae) Intra-speci®c comparisons Inter-speci®c comparisons Complex to out group References

0.012 [0.001±0.022] (Cc,Cf) 0.021 [0.000±0.036] 0.055 [0.054±0.060] Sperling & Hickey, 1994

0.003 [0.001±0.004] 0.087 [0.002±0.233] 0.904 [0.731±0.972] Harvey, 1996

Feltia (Lepidoptera: Noctuidae) Intra-speci®c comparisons Inter-speci®c comparisons Complex to out group References

0.009 [0.001±0.023] 0.022 [0.001±0.037] 0.045 [0.042±0.048] Sperling et al., 1996

0.001 [0.000±0.001] (FA, FB) 0.088 [0.007±0.175] Not available Gooding et al., 1992

Pissodes (Coleoptera: Curculionidae) Intra-speci®c comparisons Inter-speci®c comparisons Complex to out group References

Yponomeuta (Lepidoptera: Yponomeutidae) Intra-speci®c comparisons Not available Inter-speci®c comparisons 0.004 [0.001±0.006] References

Limnoporus (Hemiptera: Gerridae) Intra-speci®c comparisons Inter-speci®c comparisons Complex to out group References

Not available 0.082 [0.021±0.126]

Sperling et al., 1995

Menken, 1982

0.007 [0.005±0.009] (Ld, Ln, Lr) 0.025 [0.011±0.034] Natural hybridization 0.090 [0.085±0.095] Sperling et al., 1997

0.017 [0.002±0.043] (Ld, Ln, Lr) 0.178 [0.094±0.204] 0.641 [0.865±1.372] Sperling & Spence, 1990; Sperling et al., 1997

Degree of cross breeding4

F1 adults produced; natural hybridization Godwin & Odell, 1967; Phillips & Lanier, 1983; Boyce et al., 1994

F1 adults fertile Narang & Seawright,1990

F2 adults produced Harvey, 1997

F1 adults fertile Byers, pers. comm.

F2 adults produced; natural hybridization Arduino et al., 1983; Hendrikse, 1988 F1 adults fertile Spence, 1990; Sperling & Spence, 1991; Sperling et al., 1997

1 Pissodes complex: nemorensis (Pn), schwarzi (Pw), strobi (Ps), terminalis, anis (out group); Anopheles complex: arabiensis, bwambae (Ab), gambiae (Ag), melas (Am), merus, quadriannulatus, stephensi (out group); Choristoneura complex: biennis, fumiferana (Cf), occidentalis (Cc), orae, pinus, rosaceana (out group); Feltia complex: four pheromotypes (A±D) of jaculifera (FA, FB, FC, FD), herilis (out group); Yponomeuta complex: cagnagella, malinellus, padella; Limnoporus complex: dissortis (Ld), genitalis, notabilis (Ln), rufoscutellatus (Lr), caniculatus (out group). 2 Only species within the complex are included in intra- and inter-speci®c comparisons. 3 Distance measures used are Nei (1971) for Yponomeuta, Nei (1972) for Limnoporus and Pissodes, and Nei (1978) for the other three genera. 4 Indicates the maximum level of cross breeding under laboratory conditions, and whether there is evidence of natural hybridization within ®eld populations.

Most of the changes in inferred amino acid composition among mtDNA lineages are selectively conservative (Table 2). Three of the replacements that characterize P. anis involve changes in classes of amino acid. However, two of these replacements are complementary and in close proximity on the carboxy terminal of COI; the hydrophilic S is replaced with hydrophobic A at 2921, and A is replaced with hydrophilic P at 2933. Therefore it is likely that one of these substitutions compensates for a mutation causing the

earlier substitution. The substitution at 2459 involves replacement of the neutral Q with the negativelycharged E, which suggests a selective basis for this di€erence.

Phylogenetic relationships Phylogenetic analysis based on the entire 810-bp sequence revealed that P. nemorensis and P. terminalis are most closely related, and that these two species form a clade with P. strobi (Fig. 3). This phylogeny # 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

Pissodes mtDNA sequence divergence

agrees with that reconstructed on the basis of RFLP data for half of COI and all of COII (Langor & Sperling, 1995). In contrast, Boyce et al. (1994) found that P. schwarzi was the closest relative to the nemorensis± terminalis clade. Both of these phylogenies, however, disagree with those based on allozyme data (Phillips, 1984), cytogenetic data (Smith & Takenouchi, 1962), and morphology (Hopkins, 1911), and these di€erences are discussed in detail by Langor & Sperling (1995). The relatively high sequence divergences in Pissodes may have implications for phylogenetic reconstruction in that the high proportion of obscured mutations may also obscure relationships among taxa, and the likelihood of this occurrence increases as sequence divergences increase. Relationships among more divergent taxa may therefore be better assessed by utilizing only transversions or by using only gene regions exhibiting low variability. Interestingly, a phylogenetic re-analysis of the sequence data, including only transversions, produced a consensus tree that was more similar to the phylogeny presented by Boyce et al. (1994) than to that presented in Fig. 3. Clearly, there is still no consensus about relationships within the P. strobi species complex. Ongoing morphological work (Langor, unpublished) may help resolve relationships.

Figure 5. Schematic showing regions of mtDNA amplified and primer locations. Primers are labelled as in Simon et al. (1994), and their sequences are as follows: (a) (TY-J-1460), 5' TACAATTTATCGCCTAAACTTCAGCC 3'; (b) (C1-J-2183), 5' CAACATTTATTTTGATTTTTTGG 3'; (c) (TL2-N-3014), 5' TCCAATGCACTAATCTGCCATATTA 3', (d) (TY-N-3771), 5' GAGACCATTACTTGCTTTCAGTCATCT 3'.

Genomic DNA was extracted using methods published elsewhere in detail (Langor & Sperling, 1994; Sperling & Hickey, 1994). This DNA was used as templates for ampli®cation of mtDNA fragments by the polymerase chain reaction (PCR) (Saiki et al., 1988). Primers and regions ampli®ed are indicated in Fig. 5. Double-stranded PCR product was cleaned with Centricon 100 micro concentrators (Amicon) and was sequenced directly using the Taq DyeDeoxy Terminator Cycle Sequencing system (Applied Biosystems). In all cases, sequence was con®rmed from both sense and antisense strands. The mtDNA of the P. strobi specimen was sequenced over 2301 bp, which correspond to bp 1461±3771 (including insertions and deletions) in the sequence of Drosophila yakuba (Clary & Wolstenholme, 1985). Due to constraints, the six other specimens of Pissodes were sequenced over only 810 bp, which correspond to bp 2191±3000 of D. yakuba. The sequences for all seven specimens have been deposited in GenBank under accession numbers U77976±U77982. Mean nucleotide and amino acid variability among regions of COI were calculated as the average number of nucleotides per position and average number of amino acids per site, respectively, observed over all seven sequences (Lunt et al., 1996). Calculation of uncorrected sequence divergences or pdistance (Swo€ord et al., 1996), transition:transversion ratios, and phylogenetic analysis was performed using PAUP 3.1 (Swo€ord, 1993). In phylogenetic analysis, variable nucleotide positions were treated as unordered characters with one state for each nucleotide. The sequence for P. anis was used as the outgroup. Extent of support for internal nodes was estimated using the bootstrap method (500 replicates) (Felsenstein, 1985) using the branch-and-bound search as implemented in PAUP.

Experimental procedures Details of specimen collection and storage procedures are detailed in Langor & Sperling (1995). Sample localities for specimens sequenced are listed in Table 4. The abdomens, elytra and wings of each specimen sequenced are stored in microcentrifuge vials that are labelled and deposited in the reference collection at the Northern Forestry Center. Only one specimen of most species was sequenced because a previous RFLP study incorporating the same section of COI (Langor & Sperling, 1995) indicated very low (1±2%) intraspeci®c divergence across most of the geographic ranges of all species. Furthermore, divergences were considered to be overestimated due to biased selection of endonucleases. Thus, sequence data for one specimen of each species was considered sucient to assess interspeci®c sequence divergence. Three specimens of P. schwarzi were sequenced to assess divergence within one haplotype (WA; Table 4).

Table 4. Collection localities, hosts, and haplotypes (based on restriction sites; sensu Langor & Sperling, 1995) for each of seven Pissodes specimens sequenced.

Species

Specimen code

Haplotype

schwarzi

112 484 585 114 137 113 604

WA WA WA TA NA SF AA

terminalis nemorensis strobi anis

263

# 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

Locality and hosts Clearwater, British Columbia: lodgepole pine boles Ellis Creek, British Columbia: lodgepole pine boles Ellis Creek, British Columbia: lodgepole pine boles Hinton, Alberta: lodgepole pine leaders Syracuse, New York: pine logs Swan Hills, Alberta: white spruce leaders McDowell, Saskatchewan: white spruce boles

264

D. W. Langor and F. A. H. Sperling

Acknowledgements We thank D. J. M. Williams and J. Leibovitz for technical assistance; J. R. Byers and G. T. Harvey for providing unpublished information presented in Table 3; and J. R. Spence and K. I. Mallett for reviewing an earlier version of the manuscript. This work was funded by the Canadian Forest Service, the Natural Sciences and Engineering Research Council of Canada to D. Hickey, and the California Agriculture Experiment Station.

References Arduino, P., Chianchi, R. and Bullini, R. (1983) Status tassonomico, ibridazione naturale e identi®cazione elettroforetica di Yponomeuta padellus e Yponomeuta malinellus (Lepidoptera: Yponomeutidae). Atti XIII Congr Naz Ital Entomol, Sestriere Torino, 1983, pp. 485±489. Beckenbach, A.T., Wei , Y.W. and Liu, H. (1993) Relationships in the Drosophila obscura species group, inferred from mitochondrial cytochrome oxidase II sequences. Mol Biol Evol 10: 619±634. Boyce, T.M., Zwick, M.E. and Aquadro, C.F. (1989) Mitochondrial DNA in the bark weevils: size, structure, and heteroplasmy. Genetics 123: 825±836. Boyce, T.M., Zwick, M.E. and Aquadro, C.F. (1994) Mitochondrial DNA in the bark weevils: phylogeny and evolution in the P. strobi species group. Mol Biol Evol 11: 183±194. Brower, A.V.Z. (1994) Phylogeny of Heliconius butter¯ies inferred from mitochondrial DNA sequences (Lepidoptera: Nymphalidae). Mol Phylogenet Evol 3: 159±174. Brower, A.V.Z. and Boyce, T.M. (1991) Mitochondrial DNA variation in monarch butter¯ies. Evolution 45: 1281±1286. Brown, J.M., Pellmyr, O., Thompson, J.N. and Harrison, R.G. (1994) Phylogeny of Greya (Lepidoptera: Perdoxidae), based on nucleotide sequence variation in mitochondrial cytochrome oxidase I and II: congruence with morphological data. Mol Biol Evol 11: 128±141. Brown, W.M., Prager, E.M., Wang, A. and Wilson, A.C. (1982) Mitochondrial DNA sequences of primates: tempo and mode of evolution. J Mol Evol 21: 1±13. Clary, D.O. and Wolstenholme, D.R. (1985) The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. J Mol Evol 22: 252±271. Crozier, R.H., Crozier, Y.C. and Mackinlay, A.G. (1989) The CO-I and CO-II region of honeybee mitochondrial DNA: evidence for variation in insect mitochondrial evolutionary rates. Mol Biol Evol 6: 399±411. DeSalle, R., Freedman, T., Prager, E.M. and Wilson, A.C. (1987) Tempo and mode of sequence evolution in mitochondrial DNA of Hawaiian Drosophila. J Mol Evol 26: 157±164. Erney, S.J., Pruess, K.P., Danielson, S.D. and Powers, T.O. (1996) Molecular di€erentiation of alfalfa weevil strains (Coleoptera: Curculionidae). Ann Entomol Soc Amer 89: 804±811. Felsenstein, J. (1985) Con®dence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783±791. Funk, D.J., Futuyma, D.J., Orti, G. and Meyer, A. (1995ba) A history of host associations and evolutionary diversi®cation for Ophraella (Coleoptera: Chrysomelidae): new evidence from mitochondrial DNA. Evolution 49: 1008±1017.

Funk, D.J., Futuyma, D.J., Orti, G. and Meyer, A. (1995b) Mitochondrial DNA sequences and multiple data sets: a phylogenetic study of phytophagous beetles (Chrysomelidae: Ophraella). Molec Biol Evol 12: 627±640. Godwin, P.A. and Odell, T.M. (1967) Experimental hybridization of Pissodes strobi and P. approximatus (Coleoptera: Curculionidae). Ann Entomol Soc Amer 60: 55±58. Gooding, R.H., Rolseth, B.M., Byers, J.R. and Herle, C.E. (1992) Electrophoretic comparisons of pheromotypes of the dingy cutworm, Feltia jaculifera (Gn.) (Lepidoptera: Noctuidae). Can J Zool 70: 79±86. Harrison, R.G. and Bogdanowicz, S.M. (1995) Mitochondrial DNA phylogeny of North American ®eld crickets: perspectives on the evolution of life cycles, songs, and habitat associations. J Evol Biol 8: 209±232. Harvey, G.T. (1996) Genetic relationships among Choristoneura species (Lepidoptera: Tortricidae) in North America as revealed by isozyme studies. Can Entomol 128: 245±262. Harvey, G.T. (1997) Interspeci®c crosses and fertile hybrids among the coniferophagous Choristoneura (Lepidoptera: Tortricidae). Can Entomol 129: in press. Hendrikse, A. (1988) Hybridization and sex-pheromone responses among members of the Yponomeuta padellus complex. Entomol Exp Appl 48: 213±223. Hopkins, A.D. (1911) Contributions toward a monograph of the barkweevils of the genus Pissodes. U S Dept Agric, Bureau Entomol, Tech Ser 20(1): 1±68. Langor, D.W. and Sperling, F.A.H. (1994) Diagnostics of the Pissodes strobi species group in western Canada, using mitochondrial DNA. The White Pine Weevil: Biology, Damage, and Management (Alfaro, R.I., Kiss, G. and Fraser, R.G., eds), pp. 174±183. Canadian Forest Service, Paci®c Forestry Center, Victoria, BC. Langor, D.W. and Sperling, F.A.H. (1995) Mitochondrial DNA variation and identi®cation of bark weevils in the Pissodes strobi species group in western Canada (Coleoptera: Curculionidae). Can Entomol 127: 895±911. Liu, H. and Beckenbach, A.T. (1992) Evolution of the mitochondrial cytochrome oxidase II gene among 10 orders of insects. Mol Phylogenet Evol 1: 41±52. Lunt, D.H., Zhang, D.-X., Szymura, J.M. and Hewitt, G.M. (1996) The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies. Insect Mol Biol 5: 153±165. Martin, A., and Simon, C. (1990) Di€ering levels of among-population divergence in the mitochondrial DNA of periodical cicadas related to historical biogeography. Evolution 44: 1066± 1080 Menken, S.B.J. (1982) Biochemical genetics and systematics of small ermine moths (Lepidoptera: Yponomeutidae). Z Zool Syst Evol 20: 131±143. Miles, S.J. (1978) Enzyme variation in the Anopheles gambiae Giles group of species (Diptera: Culicidae). Bull Entomol Res 68: 85± 96. Narang, S.K. and Seawright, J.A. (1990) Genetic di€erentiation among members of species complexes in anopheline mosquitoes (Diptera: Culicidae). Eukaryotic Chromosomes: Structural and Functional Aspects (Sobti, R.C. and Obe, G., eds), pp. 59±96. Narosa Publishing House, New Delhi. Nei, M. (1971) Identity of genes and genetic distance between populations. Genetics (Supplement) 68: 47. # 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

Pissodes mtDNA sequence divergence Nei, M. (1972) Genetic distance between populations. Am Nat 106: 283±292. Nei, M. (1978) Estimation of average heterozygosity and genetic distance froma small number of individuals. Genetics 89: 583± 590. Normark, B.B. (1996) Phylogeny and evolution of parthenogenetic weevils of the Aramigus tessellatus species complex (Coleoptera: Curculionidae: Naupactini): evidence from mitochondral DNA sequences. Evolution 50: 734±745. Phillips, T.W. (1984) Ecology and systematics of Pissodes sibling species (Coleoptera: Curculionidae). Ph.D. thesis, University of New York, Syracuse, N.Y. Phillips, T.W. and Lanier, G.N. (1983) Biosystematics of Pissodes Germar (Coleoptera: Curculionidae): feeding preference and breeding site speci®city of P. strobi and P. approximatus. Can Entomol 115:1627±1636. Saiki, R.K., Gelfand, D.H., Sto€el, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Ehrlich, H.A. (1988) Primer-directed enzymatic ampli®cation of DNA with thermostable DNA polymerase. Science 239: 487±491. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. and Flook, P. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Amer 87: 651±701. Smith, S.G. (1962) Cytogenetic pathways in beetle speciation. Can Entomol 94: 941±955. Smith, S.G. and Takenouchi, Y. (1962) Unique incompatibility system in a hybrid species. Science 138: 36±37. Smith, S.G. and Takenouchi, Y. (1969) Chromosomal polymorphism in Pissodes weevils: further on incompatibility in P. terminalis. Can J Genet Cytol 11: 761±782. Smith, S.G. and Virkki, N. (1978) Animal Cytogenetics, Vol. 3. GebruÈder Borntraeger, Berlin. Spence, J.R. (1990) Introgressive hybridization in Heteroptera: the example of Limnoporus Stl (Gerridae) species in western Canada. Can J Zool 68: 1770±1782. Sperling, F.A.H. (1993a) Mitochondrial DNA variation and Haldane's rule in the Papilio glaucus and P. troilus species groups. Heredity 71: 227±233. Sperling, F.A.H. (1993b) Mitochondrial DNA phylogeny of the Papilio machaon species group (Lepidoptera: Papilionidae). Mem Entomol Soc Canada 165: 233±242. Sperling, F.A.H., Anderson, G.S. and Hickey, D.A. (1994) A DNAbased approach to the identi®cation of insect species used for postmortem interval estimation. J Forensic Sci 39: 418± 427.

# 1997 Blackwell Science Ltd, Insect Molecular Biology 6: 255±265

265

Sperling, F.A.H., Byers, J.R. and Hickey, D.A. (1996) Mitochondrial DNA sequence variation among pheromotypes of the dingy cutworm, Feltia jaculifera (Gn.) (Lepidoptera: Noctuidae). Can J Zool 74: 2109±2117. Sperling, F.A.H. and Harrison, R.G. (1994) Mitochondrial DNA variation within and between species of the Papilio machaon group of swallowtail butter¯ies. Evolution 48: 408±422. Sperling, F.A.H. and Hickey, D.A. (1994) Mitochondrial DNA sequence variation in the spruce budworm species complex (Choristoneura: Lepidoptera). Mol Biol Evol 11: 656±665. Sperling, F.A.H. and Hickey, D.A. (1995) Ampli®ed mitochondrial DNA as a diagnostic marker for species of conifer-feeding Choristoneura (Lepidoptera: Tortricidae). Can Entomol 127: 277±288. Sperling, F.A.H., Landry, J.-F. and Hickey, D.A. (1995) DNA-based identi®cation of introduced ermine moth species in North America (Lepidoptera: Yponomeutidae). Ann Entomol Soc Amer 88: 155±162. Sperling, F.A.H. and Spence, J.R. (1990) Allozyme survey and relationships of Limnoporus Stl species (Heteroptera: Gerridae). Can Entomol 122: 29±42. Sperling, F.A.H. and Spence, J.R. (1991) Structure of an asymmetric hybrid zone between two water strider species (Hemiptera: Gerridae: Limnoporus). Evolution 45:1370±1383. Sperling, F.A.H., Spence, J.R. and Anderson, N.M. (1997) Mitochondrial DNA, allozyme, morphology and hybrid compatibility in Limnoporus water striders: do they track species phylogenies? Ann Entomol Soc Amer 90: in press. Swo€ord, D. (1993) PAUP: phylogenetic analysis using parsimony, version 3.1. Illinois Natural History Survey, Champaign. Swo€ord, D.L., Olsen, G.J., Waddell, P.J. and Hillis, D.M. (1996) Phylogenetic inference. Molecular Systematics, 2nd edn (Hillis, D.M., Mortiz, C. and Mable, B.K., eds), pp. 407±514. Sinauer Associates Inc., Sunderland, Massachusetts. Tamura, K. (1992a) Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+Ccontent biases. Mol Biol Evol 9: 678±687. Tamura, K. (1992b) The rate and pattern of nucleotide substitution in Drosophila mitochondrial DNA. Mol Biol Evol 9: 814±825. Vogler, A.P., DeSalle, R., Assmann, T., Knisley, C.B. and Schultz, T.D. (1993) Molecular population genetics of the endangered tiger beetle Cicindela dorsalis (Coleoptera: Cicindelidae). Ann Entomol Soc Amer 86: 142±152. Willis, L.G., Winston, M.L. and Honda, B.M. (1992) Phylogenetic relationships in the honeybee (genus Apis) as determined by the sequence of the cytochrome oxidase II region of mitochondrial DNA. Mol Phylogenet Evol 1: 169±178.