ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, July 2009, p. 2841–2845 0066-4804/09/$08.00⫹0 doi:10.1128/AAC.01408-08 Copyright © 2009, American Society for Microbiology. All Rights Reserved.
Vol. 53, No. 7
Noncanonical Vancomycin Resistance Cluster from Desulfitobacterium hafniense Y51䌤 Lindsay Kalan,1 Sara Ebert,2 Tom Kelly,3 and Gerard D. Wright1* Michael G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Canada1; Department of Biological Sciences, University of Alberta, Edmonton, Alberta, Canada2; and Department of Microbiology, St. Josephs’ Health Care, Hamilton, Ontario, Canada3 Received 20 October 2008/Returned for modification 16 December 2008/Accepted 17 April 2009
phenotype is named after the ligase VanA, conferring highlevel resistance to both vancomycin and teicoplanin, while organisms displaying the VanB, -D, or -F phenotype harbor DAla–D-Lac in their cell walls but have varying levels of induction to different glycopeptide antibiotics. The vanHAX cluster (Fig. 1) is conserved in pathogens (VRE) and in glycopeptide-producing actinomycetes (17, 19) and can also be found embedded in the genomes of environmental bacteria that do not produce glycopeptides, such as Streptomyces coelicolor (12), Paenibacillus sp. (8–10), and Frankia sp. (L. Kalan and G. D. Wright, unpublished data). Furthermore, in a survey of ⬃500 soil bacteria, 1% were shown to be vancomycin resistant, and all resistant strains save 1 contained a vanHAX cluster, as determined by PCR (6). Regardless of their origin (VRE, environmental bacterium, or glycopeptide producer), these genes in high-level vancomycin-resistant organisms are always found in a vanHAX cluster (Fig. 1). Despite the ubiquity of this cluster, there are a number of different glycopeptide antibiotic resistance phenotypes in VRE and other bacteria (15). Given the conservation of the vanHAX cluster and of the associated biochemical mechanism, differences in glycopeptide resistance phenotypes are attributed to variable regulation of the expression of these genes by a two-component regulatory system comprised of VanS, a His kinase, and VanR, a response regulator (2) (Fig. 1). A scan of recently sequenced genomes identified a vanA homolog in the genome of Desulfitobacterium hafniense Y51, a strictly anaerobic, gram-positive rod with a low G⫹C content isolated from a site in Japan contaminated with halogenated organic compounds (18, 21). Surprisingly, this homolog was not found in a vanHAX cluster but with a nearby vanX and a vanW homolog, encoding a protein of unknown function associated in VRE with the VanB phenotype (Fig. 1). A similar arrangement was also found in the unpublished
The glycopeptide antibiotics, such as vancomycin and teicoplanin, continue to be front-line therapies for the treatment of serious infections caused by gram-positive pathogens. These antibiotics act on the outside of the cell by binding the terminal D-alanyl–D-alanine of nascent peptidoglycan and precursors, such as lipid II, by a series of five hydrogen bonds (4, 17). Clinical glycopeptide antibiotic resistance generally involves the biosynthesis of peptidoglycan, terminating in D-Ala–D-X, where X is either Ser, whose side chain hydroxymethyl group sterically interferes with the antibiotic-dipeptide interaction (20), or the ␣-hydroxy acid lactate (Lac) (4). High-level vancomycin resistance in vancomycin-resistant enterococci (VRE) and in glycopeptide-producing bacteria is associated with the substitution of D-Lac, resulting in a terminal depsipeptide (ester linkage) rather than a peptide (amide linkage). Unlike D-Ala–D-Ser, D-Ala–D-Lac is isosteric with D-Ala–D-Ala, but the substitution of the amide for an ester removes a critical hydrogen bond donor required for optimal antibiotic interaction with peptidoglycan. This single change results in a 1,000fold decrease in the affinity of the antibiotic for its target and in clinical drug resistance (4). Three genes are essential for D-Ala–D-Lac-mediated vancomycin resistance in enterococci (VRE): vanH, vanA, and vanX. vanH encodes a pyruvate dehydrogenase that converts pyruvate to D-Lac. vanA encodes an ATP-dependent depsipeptide ligase that catalyzes the synthesis of D-Ala–D-Lac. vanX encodes a dipeptidase that cleaves existing D-Ala–D-Ala in the cell, ensuring a cell wall enriched in D-Ala–D-Lac (1, 13). The
* Corresponding author. Mailing address: Institute for Infectious Disease Research, McMaster University, 1200 Main St. W, Hamilton, Canada L8N 3Z5. Phone: (905) 525-9140. Fax: (905) 522-9033. E-mail:
[email protected]. 䌤 Published ahead of print on 4 May 2009. 2841
Downloaded from http://aac.asm.org/ on January 12, 2016 by guest
The glycopeptide vancomycin is a drug of last resort for infection with gram-positive organisms, and three genes are vital to resistance: vanH, vanA, and vanX. These genes are found in a vanHAX cluster, which is conserved across pathogenic bacteria, glycopeptide antibiotic producers, and other environmental bacteria. The genome sequence of the anaerobic, gram-positive, dehalogenating bacterium Desulfitobacterium hafniense Y51 revealed a predicted vanA homolog; however, it exists in a vanAWK-murFX cluster, unlike those of other vancomycin-resistant organisms. Using purified recombinant VanA from D. hafniense Y51, we determined its substrate specificity and found it to have a 42-fold preference for D-lactate over D-alanine, confirming its activity as a D-Ala–D-Lac ligase and its annotation as VanA. Furthermore, we showed that D. hafniense Y51 is highly resistant to vancomycin, with a MIC for growth of 64 g/ml. Finally, vanADh is expressed during growth in vancomycin, as demonstrated by reverse transcription-PCR. This finding represents a new glycopeptide antibiotic resistance gene cluster and expands the genetic diversity of resistance to this important class of antibiotic.
2842
KALAN ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
genome of D. hafniense DCB-2 (http://genome.jgi-psf.org /draft_microbes/desha/desha.home.html). Here, we report the biochemical characterization of this putative VanA as an active D-Ala–D-Lac ligase, part of a noncanonical vancomycin resistance gene cluster in the genome of D. hafniense Y51. MATERIALS AND METHODS Cloning, expression, and purification of D. hafniense Y51 VanA (VanADh) and Ddl (DdlDh) homologs. D. hafniense Y51 and its genomic DNA were generously provided by Masatoshi Goto and Kensuke Furukawa (Kyushu University, Fukuoka, Japan). Cultures were maintained in m-ISA medium consisting of 1% tryptone peptone, 0.35% sodium lactate, 0.05% Na2SO3, 0.2% MgSO4 · 7H2O, 0.05% iron(III) ammonium, and 0.001% resazurin, pH 7.2, and were incubated at 30°C. Cloning of the putative D-Ala–D-Lac and D-Ala–D-Ala ligase genes from D. hafniense Y51 was achieved by PCR amplification of the genes DSY3690 and DSY1579, respectively, from genomic DNA. Primers were designed to amplify 1.1-kb fragments from D. hafniese Y51 genomic DNA. The primers contained attB sites engineered to facilitate cloning using the Gateway technology (Invitrogen, Carlsbad, CA). The specific primers used for DSY3690 were 5⬘-GGGGA CAAGTTTGTACAAAAAAGCAGGCTTAATGGATCGGTTGAAAATCGC A-3⬘ and 5⬘-GGGGACCACTTTGTACAAGAAAGCTGGGTCCCCATCCTA TCGGCA-3⬘. For DSY1579, the specific primer sequences were 5⬘-GGGGAC AAGTTTGTACAAAAAAGCAGGCTYYCATATGATGACACGGCAAAA GATTATTATTC-3⬘ and 5⬘-GGGACCACTTTGTACAAGAAAGCTGGGTY AAGCTTCTAACGGGATATTTTCCGGG-3⬘. The resulting PCR products were inserted into the pDEST17 destination vector (Invitrogen, Carlsbad, CA) containing a six-His tag for ease of downstream purification. Gene integrity was confirmed by DNA sequencing. The plasmids were propagated in Escherichia coli TOP10⬘ cells and subsequently used to transform E. coli BL21(DE3) Rosetta (Novagen, Darmstadt, Germany) cells for high-level protein expression under the control of the T7 promoter. For VanAAo (from the vancomycin producer Amycolatopsis orientalis C329.2), VanADh, and DdlDh overexpression, cells were propagated in 1 liter of LuriaBertani broth until the optical density at 600 nm reached 0.6. Protein expression was induced by the addition of isopropyl -D-1-thiogalactopyranoside to a final concentration of 1 mM and incubation of cultures at 16°C for 18 h. Cells were harvested and washed in 0.85% (wt/vol) NaCl before resuspension in 10 ml lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 1 mM phenylmethanesulfonyl fluoride, 1 mM DNase, pH 8.0). The cells were lysed by four passes through a French pressure cell at 1,250 lb/in2, and cell debris was removed by centrifugation at 27,000 ⫻ g for 30 min. The supernatant was collected, and purified enzyme was obtained using nickel-nitrilotriacetic acid-immobilized metal affinity chromatography (Qiagen, Valencia, CA). Fractions containing the purified enzyme were pooled and dialyzed into 50 mM HEPES, 5 mM MgCl2, 1 mM EDTA, pH 8.0, at 4°C. E. coli BL21(DE3) harboring pET28bvanAAo from A. orientalis C329.2 was
prepared as previously described (17) and purified as a six-His-tagged protein as described above. E. coli W3110 harboring pTB2 for expression of the D-Ala–DAla ligase DdlB was previously reported (24). Ddl assays. For qualitative determination of VanADh and DdlDh substrate specificities, initial enzymatic characterization was carried out using the pyruvate kinase/Lac dehydrogenase-coupled assay to monitor ADP formation (22). Amino and hydroxy acid substrate specificities were determined by thin-layer chromatography (TLC) and by using radiolabeled substrates. Due to the cost of 14 14 D-[U- C]alanine, L-[U- C]alanine was isomerized to a racemic mixture of L/D[14C]alanine with 1 unit of Bacillus stearothermophilus alanine racemase (SigmaAldrich). Ligase reaction mixtures contained 50 mM HEPES, pH 7.5, 10 mM MgCl2, 40 mM KCl, 6 mM ATP, 2 M enzyme, 0.1 Ci L/D-[U-14C]Ala, 1 mM D-Ala, and 10 mM D-X substrate. Reactions were quenched with 50% methanol and applied to a polyethyleneimine-cellulose TLC plate (Sigma-Aldrich). The plates were developed in 12:3:5 butanol-acetic acid-water, dried overnight, and exposed to a phosphor storage imaging screen. The screens were imaged using a Typhoon variable-mode imager, and the relative radioactive intensity was quantified using ImageQuant 5.2 software. Michaelis-Menten kinetics were determined by using the software program GraFit version 4.0.21 (Erithacus Software), and initial rates were determined using the nonlinear least-squares method and the following equation (14): v ⫽ (kcat/Et)[S]/(Km ⫹ [S]), where Et is total enzyme concentration and [S] is substrate concentration. RNA preparation. Cultures of D. hafniense Y51 were grown in m-ISA medium for 24 h and diluted 1/100 in m-ISA containing 0 g/ml or 125 g/ml vancomycin and incubated at 30°C for 24 or 48 h. The cultures were harvested by centrifugation for 15 min at 3,000 ⫻ g, and the pellets were resuspended in 1 ml of RNAprotect bacterial reagent (Qiagen, Valenica, CA). After subsequent centrifugation, total RNA was extracted using the RNeasy Minikit (Qiagen, Valencia, CA) following the manufacturer’s protocols for the enzymatic lysis and proteinase K digestion of bacteria (protocol 4) before the purification of total RNA (protocol 7). An on-column DNase I digestion was performed, in addition to a postelution DNase I digestion and additional column purification. RNA was quantified using a NanoDrop ND-1000 spectrophotometer and checked for genomic DNA contamination by PCR analysis. Expression analysis. Reverse transcription (RT) was carried out with 0.3 g of DNase I-treated RNA and 200 ng of random hexamers to generate cDNA using the Superscript III RT kit (Invitrogen, Carlsbad, CA). The samples were incubated at 25°C for 5 min prior to incubation at 50°C for 45 min, followed by inactivation at 70°C for 15 min. One microliter of the RT reaction mixture was used for real-time PCR with SYBR green in a SmartCycler system (Cepheid, Sunnyvale, CA). The following primers were designed to amplify a 293-bp vanADh product and a 270-bp ddlDh product in a 25-l reaction volume. The vanADh primers were 5⬘-TTCTTCTTGGCGGCATACTT-3⬘ and 5⬘-ATCTGGT GTTTCCCGTTCTG-3⬘, while the ddlDh primers were 5⬘-GTGAAGAACGGG GAAAATCA-3⬘ and 5⬘-CAATCCGGAGAACATGAGGT-3⬘. The results were normalized by the 2⫺⌬⌬CT method (16) to 16S rRNA expression using the primers 5⬘-AGGCCTTCGGGTTGTAAAGT-3⬘ and 5⬘-ATACCCAGTTTCCG ATGCAG-3⬘ to amplify a 237-bp product. The products were analyzed on a 1% agarose gel to confirm that a single product was amplified.
Downloaded from http://aac.asm.org/ on January 12, 2016 by guest
FIG. 1. Organization of vancomycin resistance cassettes in glycopeptide-producing (Actinoplanes teichomyceticus and Streptomyces toyocaensis), pathogenic (VRE VanA and VanB), and environmental (Paenibacillus apiarius PA-B2B, S. coelicolor, and D. hafniense Y51 and DCB-2) bacteria. Each arrow represents a single ORF and direction of transcription. Unless otherwise written, all genes have the “van” prefix removed.
VOL. 53, 2009
NEW VANCOMYCIN RESISTANCE CLUSTER IN DESULFITOBACTERIUM
TABLE 1. Comparison of the percents identity between DdlDh and VanADh and various Ddlsa % Identity Enzyme VanADh
34 31 31 35 35 37 35 36 35 36 36
31 33 34 31 64 66 61 64 74 70 67
VanXDh
VanWDh
66 65 66 69 74 74 71 54 51
a DdlB (E. coli), DdlBc (Bacillus cereus), DdlCb (Clostridium botulinum A strain ATCC 3502); DdlStm (Salmonella enterica serovar Typhimurium), VanASt (Streptomyces toyocaensis), VanAAt (Actinoplanes teichomyceticus), VanAAo (A. orientalis C329.2), VRE VanA (Enterococcus faecium), VanASt (S. toyocaensis), and VanA, -B, -D, and -F (enterococcal clinical phenotypes).
Antibiotic susceptibility testing. D. hafniense Y51 susceptibility tests for vancomycin and teicoplanin using disc diffusion assays were performed according to CLSI methods (5). In addition, the MIC for vancomycin was determined using Etest gradient strips (Dalvagen, Solna, Sweden). The organism was grown on purchased brucella agar with 5% sheep blood, vitamin K, and hemin supplements (PML Microbiologicals, Wilsonville, OR), and the manufacturer’s protocol was followed for MIC determination.
other vancomycin-resistant proteins to unlinked peptidoglycan based on the presence of a G5 domain in the C terminus, which may bind to N-acetylglucosamine residues (3). In order to experimentally verify the predicted biochemical activities of the D. hafniense Y51 predicted D-Ala–D-X ligase genes, each was overexpressed as six-His tag fusions in E. coli and purified by immobilized metal affinity chromatography by standard methods, yielding pure proteins (Fig. 2). Substrate specificities of recombinant D-Ala–D-X ligases. The amino acid specificities of VanADh and DdlDh were qualitatively determined using D-[U-14C]Ala and unlabled D-amino and D-hydroxy acid substrates, followed by separation of the products by TLC on a polyethyleneimine-cellulose plate. DdlB, the D-Ala–D-Ala ligase from E. coli, and VanAAo, the D-Ala– D-Lac ligase from the vancomycin producer A. orientalis C329.2, were used as positive controls. DdlB is only able to produce D-Ala–D-Ala, while VanAAo catalyzes D-Ala–D-Lac synthesis. Although the amino acid sequence identity is only 34%, DdlDh exhibits activity similar to that of E. coli DdlB, producing only D-Ala–D-Ala even in the presence of excess (10-fold) D-Lac. In contrast, the conserved amino acid identity between VanADh and VanAAo is 67%, and VanADh shows substrate specificity similar to that of VanAAo, producing only D-Ala–D-Lac (Table 1 and Fig. 3). The functions of the two D-D ligases in D. hafniense Y51 clearly show different substrate specificities, indicating that VanADh is able to produce D-Ala–D-Lac, an observation consistent with our hypothesis that vanAW-murFKX may encode an alternate glycopeptide resistance cluster.
RESULTS AND DISCUSSION Expression and characterization of VanA and Ddl homologs from D. hafniense Y51. A BLAST search of the D. hafniense Y51 genome revealed two predicted D-Ala–D-X ligase genes. The first, DSY1579, encodes a predicted D-Ala–D-Ala ligase (DdlDh), while the product of the second, DSY3690, is homologous to VanA-like D-Ala–D-Lac ligases (VanADh) (Table 1). The ddlDh gene is located proximal to other genes predicted to encode peptidoglycan assembly proteins (e.g., D-D-carboxypeptidase). Conversly, vanADh is clustered with murF, vanX, vanK, and vanW homologs and a predicted vanSR two-component regulatory system (Fig. 1). We hypothesized that this novel vanAWK-murFX cluster might encode an alternative glycopeptide resistance cluster rather than the canonical vanHAX found in VRE, glycopeptide producers, and other environmental bacteria. As noted above, VanX is a D-Ala–D-Ala hydrolase required to eliminate constitutively produced D-Ala–D-Ala. VanK (11, 12) is a FemX protein that catalyzes the crosslinking reaction of peptidoglycan terminating in D-Ala–D-Lac (where native FemX enzymes do not), while MurF adds the D-Ala–D-Lac depsipeptide to the growing chain (7). VanW, on the other hand, is a protein of unknown function associated with VanB phenotype resistance clusters (Fig. 1). Bateman et al. hypothesized that VanW might be important in localizing
FIG. 2. Purification of recombinant D. hafniense D-Ala:D-X ligases. Ni-nitrilotriacetic acid-purified fractions of VanADh (lane A) and DdlDh (lane B) were separated on a 4 to 12% sodium dodecyl sulfatepolyacrylamide gel and stained with Coomassie blue.
Downloaded from http://aac.asm.org/ on January 12, 2016 by guest
DdlB DdlBc DdlCb DdlStm VanA VanB VanD VanF VanASt VanAAt VanAAo VanX VanXB VanXD VanXF VanXAt VanXSt VanXAo VanWG VanWB
DdlDh
2843
2844
KALAN ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
Steady-state kinetics of D-Ala:D-Ala/Lac ligases. We performed steady-state kinetic analyses to quantify the enzyme activity of VanADh. Purified ligases were kinetically characterized for the utilization of D-Ala, D-Lac, and ATP by monitoring the change in absorbance at 340 nm with the coupled pyruvate kinase-lactate dehydrogenase continuous ADP release assay. The results (Table 2) indicated that D-Lac is the preferred substrate for VanADh, where the Km is 0.53 mM compared to 22 mM for D-Ala. Furthermore, the catalytic efficiency (kcat/ Km) is 42-fold higher for D-Lac under the same conditions. DdlDh was unable to use D-Lac as a substrate (10 mM), and the kcat/Km for D-Ala is comparable to the kcat/Km for D-Lac utilization by VanADh (3.1 ⫻ 103 and 1.1 ⫻ 103 M⫺1 s⫺1, respectively). The enzymes bind two molecules of D-amino/hydroxy acids to two distinct binding sites (24). The first is always D-Ala; thus, we measure the kinetic parameters for the second binding site by using the coupled assay. Although the active site discriminates which hydroxy amino acid it prefers, in the case of VanADh, some D-Ala–D-Ala is concurrently being formed, in addition to D-Ala–D-Lac. Unfortunately, it is difficult to resolve the rate and the effect on D-Ala–D-Lac formation using the spectrophotometric coupled assay. The markedly large increase in the kcat/Km is a good indicator of the discrimination for D-Lac in the active site of the enzyme; however, this assay is unable to directly quantify the formation of D-Ala–D-Lac. Therefore, a direct TLC assay involving radiolabeled sub-
TABLE 2. Kinetic characterization of D. hafniense Y51 D-Ala:D-Lac and D-Ala:D-Ala ligasesa Enzyme
Product
Km (mM)
kcat (s⫺1)
kcat/Km (M⫺1 s⫺1)
22 ⫾ 2.6 0.58 ⫾ 0.03 0.53 ⫾ 0.06 0.61 ⫾ 0.02 ATP 0.013 ⫾ 0.001 0.65 ⫾ 0.01 14 0.80 ⫾ 0.08 0.0076 ⫾ 0.003 D-关 C兴Ala–Lac
2.6 ⫻ 101 1.1 ⫻ 103 4.7 ⫻ 104 1.7 ⫻ 102
0.26 ⫾ 0.05 0.018 ⫾ 0.002
3.1 ⫻ 103 3.8 ⫻ 104
VanADh
D-Ala–D-Ala D-Ala–D-Lac
DdlDh
D-Ala–D-Ala
ATP
0.80 ⫾ 0.05 0.68 ⫾ 0.02
a Using the pyruvate kinase/lactate dehydrogenase assay or the radioactive assay.
D-关
14
C兴Ala
FIG. 4. Change in expression levels of vanADh (hatched bars) and ddlDh (solid bars) after growth in 125 g/ml vancomycin. The relative RNA levels were normalized to 16S rRNA levels after 24 and 48 h of growth.
strates was employed. Using this approach, the Km for D-Lac was 0.8 mM, while the kcat was 7.6 ⫻ 10⫺2 s⫺1 and the kcat/Km was 1.7 ⫻ 102 M⫺1 s⫺1 (Table 2). D. hafniense Y51 is vancomycin resistant. D. hafniense Y51 was found to be resistant to vancomycin, as indicated by a lack of inhibition of growth around a 5-g vancomycin paper disc, while it was only intermediately resistant to teicoplanin, as indicated by a 40-mm zone of inhibition around a 30-g disc. The MIC for vancomycin was determined by using Etest gradient strips and was found to be 64 g/ml. vanADh expression levels during growth in vancomycin. The induction of vancomycin resistance by vanADh was examined by real-time PCR. Relative RNA levels were normalized to 16S rRNA expression, and it was determined that vanADh expression was increased 181- and 256-fold after 24 and 48 h of incubation in vancomycin, respectively. Furthermore, ddlDh RNA levels remained constant regardless of growth in the presence or absence of vancomycin. The changes of ddlDh upon addition of vancomycin were only 1.19- and 1.23-fold after 24 and 48 h of growth, respectively (Fig. 4). Summary and conclusions. We have identified a glycopeptide antibiotic resistance cluster with novel gene organization in the dehalorespiring organism D. hafniense Y51. This cluster includes predicted vanA and vanX genes, as well as additional auxiliary genes predicted to be required for inducible glycopeptide resistance. Biochemical analysis of recombinant VanADh confirmed that it is a functional D-Ala–D-Lac ligase. Although a D-Lac dehydrogenase (vanH) was not part of this new cluster, four annotated D-isomer-specific 2-hydroxyacid dehydrogenase genes (DSY0996, DSY1673, DSY3442, and DSY4020) are present in the genome of D. hafniense Y51. The organism exhibits high-level resistance to vancomycin even though these dehydrogenases have less than 30% identity to VanH, and therefore, at least one of the gene products can provide the requisite D-Lac substrate for VanADh. This new vancomycin resistance cluster expands our understanding of the genetic diversity that encompasses the vancomycin resistome, which includes all the genes in pathogenic and environmental bacteria that can give rise to glycopeptide resistance (23). The presence of this new vancomycin resistance cluster raises a number of unanswered questions, including why D. hafniense harbors these genes (i.e., antibiotic resistance or some physiological advantage for D-Ala–D-Lac
Downloaded from http://aac.asm.org/ on January 12, 2016 by guest
FIG. 3. Substrate specificities of D-Ala–D-X ligases. Substrate specificity was examined using D-[U-14C]Ala and either D-Ala or D-Lac. The products of each reaction were separated by TLC and exposed to a phosphor storage screen. All reaction mixtures contained 0.1 Ci 14 D-[U- C]Ala and 10 mM D-Ala (lanes a), 1 mM D-Ala and 10 mM D-Lac (lanes b), or 10 mM D-Lac (lanes c). VanADh exhibited activity similar to that of the D-Ala–D-Lac ligase VanAAo from A. orientalis, while DdlDh showed activity similar to that of the E. coli D-Ala–D-Ala ligase DdlB. The negative control [(⫺)] had no enzyme.
VOL. 53, 2009
NEW VANCOMYCIN RESISTANCE CLUSTER IN DESULFITOBACTERIUM
terminating cell walls), whether this gene cluster is more widespread in other organisms, and whether this new cluster can be mobilized into pathogenic bacteria like vanHAX. While the answers to these questions require further study, what is clear is that continued microbial-genome sequencing is revealing the remarkable depth of the antibiotic resistome within microbial populations across the globe.
10.
11.
12.
ACKNOWLEDGMENTS
REFERENCES 1. Arthur, M., and P. Courvalin. 1993. Genetics and mechanisms of glycopeptide resistance in enterococci. Antimicrob. Agents Chemother. 37:1563–1571. 2. Arthur, M., C. Molinas, and P. Courvalin. 1992. The VanS-VanR twocomponent regulatory system controls synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. J. Bacteriol. 174:2582– 2591. 3. Bateman, A., M. T. Holden, and C. Yeats. 2005. The G5 domain: a potential N-acetylglucosamine recognition domain involved in biofilm formation. Bioinformatics 21:1301–1303. 4. Bugg, T. D., G. D. Wright, S. Dutka-Malen, M. Arthur, P. Courvalin, and C. T. Walsh. 1991. Molecular basis for vancomycin resistance in Enterococcus faecium BM4147: biosynthesis of a depsipeptide peptidoglycan precursor by vancomycin resistance proteins VanH and VanA. Biochemistry 30:10408– 10415. 5. CLSI. 2007. Methods for antimicrobial susceptibility testing of anaerobic bacteria, 7th ed. Approved standard M11-A7, vol. 27. CLSI, Wayne, PA. 6. D’Costa, V. M., K. M. McGrann, D. W. Hughes, and G. D. Wright. 2006. Sampling the antibiotic resistome. Science 311:374–377. 7. El Zoeiby, A., F. Sanschagrin, and R. C. Levesque. 2003. Structure and function of the Mur enzymes: development of novel inhibitors. Mol. Microbiol. 47:1–12. 8. Guardabassi, L., and Y. Agerso. 2006. Genes homologous to glycopeptide resistance vanA are widespread in soil microbial communities. FEMS Microbiol. Lett. 259:221–225. 9. Guardabassi, L., H. Christensen, H. Hasman, and A. Dalsgaard. 2004.
13. 14. 15. 16.
17.
18.
19.
20.
21. 22.
23. 24.
Members of the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal glycopeptide resistance genes vanA and vanB. Antimicrob. Agents Chemother. 48:4915–4918. Guardabassi, L., B. Perichon, J. van Heijenoort, D. Blanot, and P. Courvalin. 2005. Glycopeptide resistance vanA operons in Paenibacillus strains isolated from soil. Antimicrob. Agents Chemother. 49:4227–4233. Hong, H. J., M. I. Hutchings, L. M. Hill, and M. J. Buttner. 2005. The role of the novel Fem protein VanK in vancomycin resistance in Streptomyces coelicolor. J. Biol. Chem. 280:13055–13061. Hong, H. J., M. I. Hutchings, J. M. Neu, G. D. Wright, M. S. Paget, and M. J. Buttner. 2004. Characterization of an inducible vancomycin resistance system in Streptomyces coelicolor reveals a novel gene (vanK) required for drug resistance. Mol. Microbiol. 52:1107–1121. Kahne, D., C. Leimkuhler, W. Lu, and C. Walsh. 2005. Glycopeptide and lipoglycopeptide antibiotics. Chem. Rev. 105:425–448. Leatherbarrow, R. J. 1992. GraFit 4.0.21. Erithacus Software Ltd., Horley, United Kingdom. Levine, D. P. 2006. Vancomycin: a history. Clin. Infect. Dis. 42(Suppl. 1): S5–S12. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2⫺⌬⌬CT method. Methods 25:402–408. Marshall, C. G., I. A. Lessard, I. Park, and G. D. Wright. 1998. Glycopeptide antibiotic resistance genes in glycopeptide-producing organisms. Antimicrob. Agents Chemother. 42:2215–2220. Nonaka, H., G. Keresztes, Y. Shinoda, Y. Ikenaga, M. Abe, K. Naito, K. Inatomi, K. Furukawa, M. Inui, and H. Yukawa. 2006. Complete genome sequence of the dehalorespiring bacterium Desulfitobacterium hafniense Y51 and comparison with Dehalococcoides ethenogenes 195. J. Bacteriol. 188: 2262–2274. Pootoolal, J., M. G. Thomas, C. G. Marshall, J. M. Neu, B. K. Hubbard, C. T. Walsh, and G. D. Wright. 2002. Assembling the glycopeptide antibiotic scaffold: the biosynthesis of A47934 from Streptomyces toyocaensis NRRL15009. Proc. Natl. Acad. Sci. USA 99:8962–8967. Reynolds, P. E., H. A. Snaith, A. J. Maguire, S. Dutka-Malen, and P. Courvalin. 1994. Analysis of peptidoglycan precursors in vancomycin-resistant Enterococcus gallinarum BM4174. Biochem. J. 301:5–8. Villemur, R., M. Lanthier, R. Beaudet, and F. Lepine. 2006. The Desulfitobacterium genus. FEMS Microbiol. Rev. 30:706–733. Wampler, D. E., and E. W. Westhead. 1968. Two aspartokinases from Escherichia coli. Nature of the inhibition and molecular changes accompanying reversible inactivation. Biochemistry 7:1661–1671. Wright, G. D. 2007. The antibiotic resistome: the nexus of chemical and genetic diversity. Nat. Rev. Microbiol. 5:175–186. Zawadzke, L. E., T. D. Bugg, and C. T. Walsh. 1991. Existence of two D-alanine:D-alanine ligases in Escherichia coli: cloning and sequencing of the ddlA gene and purification and characterization of the DdlA and DdlB enzymes. Biochemistry 30:1673–1682.
Downloaded from http://aac.asm.org/ on January 12, 2016 by guest
We are grateful for the assistance of Julia Foght, University of Alberta. We thank Masatoshi Goto and Kensuke Furukawa (Kyushu University, Fukuoka, Japan) for donating genomic DNA and cultures of D. hafniense Y51. This work was supported by grant MT-13536, a graduate student award from the Canadian Institutes of Health Research, and a Canada Research Chair to G.D.W.
2845
