Supplemental Data Biosynthesis of the Cyclooligomer Depsipeptide Beauvericin, a Virulence Factor of the Entomopathogenic Fungus Beauveria bassiana

Chemistry & Biology 15

Supplemental Data Biosynthesis of the Cyclooligomer Depsipeptide Beauvericin, a Virulence Factor of the Entomopathogenic Fungus Beauveria bassiana Yuquan Xu, Rousel Orozco, E.M. Kithsiri Wijeratne, A.A. Leslie Gunatilaka, S. Patricia Stock, and István Molnár

Supplemental Experimental Procedures PCR Amplification of NRPS A Domains A-domain homologous sequences were amplified from B. bassiana total DNA as the template with the following four primer pairs: PS1-17A (5’-ACNGGNAARCCNAAAGG-3’) and PS2R-17A (5’-ARRTCNCCNGTYTTATA-3’); EA1f (5’-TATGTCATCTTCACCTCGGG-3’) and EA1r (5’-TGACCTGGGAGTCCATACGG-3’); EAf (5’-TRGCITAYGTIRTITTYAC-3’) and EAr (5’-TTIAMYTGIBWRTCCATDCG-3’); and FNRPSf (5’- ACITCIGGIWSHCAIGG-3’) and FNRPSr (5’-TCIACDCGYTGICCDYG-3’). The PS1-17A − PS2R-17A primer pair was described by Tanaka et al. (Tanaka et al., 2005). The EA1f − EA1r and the EAf − EAr primer pairs were both based on core motifs #3 and #8 of the D-Hivincorporating A domain of the F. equiseti enniatin synthetase (CAA79245). The primer pair FNRPSf − FNRPSr was designed based on an alignment of the core motifs #3 and #8 of different NRPS A domains from the F. graminearum (teleomorph: Gibberella zeae) strain PH-1 genome sequence and those of the F. equiseti enniatin synthetase (CAA79245). PCR reactions with these primers (40 µM, final concentration) were done with Platinum Taq DNA polymerase (Invitrogen) using a touchdown PCR profile (initial cycle: 95 oC 120 sec; first 15 amplification cycles: 95 oC 75 sec, 42 oC [decreased in each successive cycle by 0.5 oC] 150 sec, 55 oC 300 sec; next 30 amplification cycles: 95 oC 75 sec, 35 oC 150 sec, 55 oC [increased in each successive cycle by 0.5 oC] 300 sec; finishing cycle: 72 oC 600 sec). The amplified products were isolated from agarose gels and cloned into pJET1. 24 plasmids with appropriate-sized inserts were sequenced for each primer pair. RT-PCR. DNase-treated total RNA was isolated with the RNeasy Plant Mini kit with Qiashredder (Qiagen) from mycelia of B. bassiana from main stage fermentations at the start of beauvericin and bassianolide accumulation (day 2). Superscript III reverse transcriptase and random hexamer primers (Invitrogen) were used for cDNA synthesis, and Platinum Taq DNA polymerase (Invitrogen) was used for RT-PCR reactions (30 cycles of 94 oC 15 sec, 55 oC 30 sec, 72 oC 60 sec). A nested primer pair (EA1046f: 5’-TCATGATTGAGCATCAAGCG-3’; EA1046r: 5’-CTTGCCAATGAAACAGATGG-3’) that had been validated not to amplify the EA1042 sequence was used for RT-PCR (4 µM each, final concentration). DNase-treated total RNA without reverse transcription, and cDNA synthesized from total RNA that had been treated with both DNase and RNase were used as the negative controls for RT-PCR. The identity of the 401-bp RT-PCR product in test reactions was confirmed by sequencing after cloning into pJET1. Construction of the bbBeas Disruption Vector. The disruption cassette included two PCRamplified DNA fragments from the bbBeas locus covering the 5’ and the 3’ region of the bbBeas gene. For the 5’ region (bp 12,315 - 14,087), the primers Beas1 (5’-ctagATATCATGGCCGGCCTCTG-3’,

small case: sequences introduced by the primer; EcoRV restriction site underlined) and Beas2 (5’GGGAGCTGTCTCGAGAAAGGG -3’, XhoI restriction site underlined) were used. Primers Beas3 (5’aggcaTGCCGGCCGAATCATTG-3’, SphI restriction site underlined) and Beas4 (5’tgtaagCTTGGTGGGTTCCAGACC-3’, HindIII restriction site underlined) amplified the 3’ region (bp 16,429 - 17,966). These PCR products were first subcloned into pJET1 (Fermentas), and shown to be error-free by sequencing. The PCR product for the 5’ region was cloned into the SmaI - XhoI sites of pAg-H3 (Zhang et al., 2003) after digestion by EcoRV and XhoI. The resulting vector was digested with SphI - HindIII, and ligated with the similarly digested PCR product for the 3’ region. Finally, the 2,147bp XhoI - BamHI fragment of this construct (carrying the hygromycin resistance marker that is not useful in B. bassiana ATCC 7159 as this strain is highly resistant to hygromycin) was replaced with the compatible 0.94-kb fragment of pCB1635 (Sweigard et al., 1997) that contains the bar selectable marker gene. This procedure places the disruption cassette in between the left and right borders of the TDNA on the pAg1-H3 vector. Construction of the bbBeas Expression Vector. The sfp phosphopantheteinyl transferase of B. subtilis was amplified using the primers 5’-atacatATGAAGATTTACGGAATTTATATG-3’ and 5’-agactcgagTTATAAAAGCTCTTCGTACGAG-3’ (small case: bases introduced by the primers, restriction sites underlined), and cloned as an NdeI - XhoI fragment into the second multiple cloning site of pACYCDuet-1 (Novagen). The B. bassiana bbBeas gene is predicted not to include introns. The 5’ region of this gene was amplified with the primers: 5’-tagcggccgccaacATGGAGCCGCTCAAAAATGT-3’ (NotI site underlined, small case: bases introduced by the primer), and 5’-GAGAGATCTGATGTGTGCAGCC-3’ (BglII site underlined), and cloned into pJET1. The 3’ region of the bbBeas gene was amplified with the primers 5’-AGCCACGCATATGCAAAAGGCGT-3’ (NdeI site underlined), and 5’-tactctagactTCACAAAGCCGAGTTTAGACT-3’ (XbaI site underlined, small case: bases introduced by the primer), and initially cloned into pJET1. All PCR products were confirmed to be errorfree by sequencing. The PCR product for the 3’ region of the bbBeas gene was released from pJET1 as an XbaI fragment and ligated into the XbaI site of the pJET1-derived vector already carrying the PCR product for the 5’ region. The bbBeas gene was next reconstituted by inserting a BglII - NdeI restriction fragment (bp 13,126 - 19,849) from fBbas11F05. The reconstituted gene was released as a NotI - XbaI fragment. This was ligated with the NotI-digested pACYCDuet-1 derivative already containing the sfp gene, the free ends of the linear intermediate were filled in, and finally the pACYC-bbBeas-sfp vector was circularized by ligation.

Supplemental References Sweigard, J., Chumley, F., Carroll, A., Farrall, L., and Valent, B. (1997). A series of vectors for fungal transformation. Fungal Genet. Newsl. 44, 52–53. Tanaka, A., Tapper, B.A., Popay, A., Parker, E.J., and Scott, B. (2005). A symbiosis expressed nonribosomal peptide synthetase from a mutualistic fungal endophyte of perennial ryegrass confers protection to the symbiotum from insect herbivory. Mol. Microbiol. 57, 1036–1050. Zhang, A., Lu, P., Dahl-Roshak, A.M., Paress, P.S., Kennedy, S., Tkacz, J.S., and An, Z. (2003). Efficient disruption of a polyketide synthase gene (pks1) required for melanin synthesis through Agrobacterium-mediated transformation of Glarea lozoyensis. Mol. Gen. Genomics 268, 645– 655.