British Journal of Haematology, 2002, 116, 812–816
Typical essential thrombocythaemia does not express bcr–abelson fusion transcript G. Damaj, 1 E. Delabesse, 2 C. Le Bihan, 3 V. Asnafi, 2 M. Rachid, 1 F. Lefre` re, 1 I. Radford-Weiss, 4 E. Macintyre, 2 O. Hermine 1 and B. Varet 1 1Service d’He´matologie, 2Service d’He´matologie Biologique, 3 De´partement de Biostatistique et d’Informatique Me´dicale, and 4Laboratoire de Cytoge´ne´tique, Hoˆpital Necker Enfants-Malades, Paris, France Received 25 May 2001; accepted for publication 2 October 2001
Summary. Essential thrombocythaemia (ET) is a chronic myeloproliferative disorder (MPD) characterized by an elevated platelet count and no identifiable underlying primary cause. According to the diagnostic criteria of the Polycythemia Vera Study Group (PVSG), ET lacks features diagnostic for other MPDs, including the Philadelphia chromosome (Ph) or bcr–abl rearrangement. Recently, some authors have reported bcr–abl transcript positivity in ET patients, but these findings remain controversial. The aim of this study was to investigate whether the bcr–abl transcript could be found in ET patients and to verify the hypothesis of a new ET variant. ET patients (n ¼ 121) with a median age at diagnosis of 55 years were enrolled. The bcr–abl transcript status was examined by multiplex reverse transcription–polymerase chain reaction. Only two cases were positive for bcr–abl, one of which had the Ph at diagnosis. The positive bcr–abl transcript was associated, in
both cases, with mild basophilia at diagnosis. After a median follow-up of 43 months (0–309 months), two patients in the bcr–abl-negative group developed Ph and bcr–abl-negative acute myeloid leukaemia (AML). In contrast, one of the two patients in the bcr–abl-positive group died from AML 13 years after diagnosis. In conclusion, our data on a large group of patients shows the rarity of the bcr–abl transcript in well-established ET. However, a subset of patients with apparent ET and basophilia may express the transcript and may constitute a novel entity intermediate between chronic myeloid leukaemia (CML) and typical ET. A prospective study is warranted in order to define better the clinical and biological characteristics of bcr–abl-expressing ET.
Essential thrombocythaemia (ET) is a chronic myeloproliferative disorder (MPD) that originates from a multipotent stem cell and is characterized by an elevated platelet count for which neither a primary cause nor diagnostic signs for other MPDs have been found. Stringent diagnostic criteria have been proposed by the Polycythemia Vera Study Group (PVSG), including the absence of the Philadelphia chromosome (Ph) or its molecular equivalent, the bcr–abl transcript (Murphy et al, 1986). The Ph is a hallmark of chronic myeloid leukaemia (CML). It results from a reciprocal translocation between the long arm of chromosome 9 and chromosome 22 [t(9;22)(q34;q11)] disrupting the bcr and abelson (abl) genes and giving rise to a chimaeric bcr–abl transcript. This mRNA encodes a fusion protein with transforming ability, which is probably responsible for the
poor prognosis in CML, with a median overall survival of 5 years. The prognosis in ET is good, and the overall survival of patients with this disease does not differ significantly from the normal population. As the prognosis and treatment of ET and CML are considerably different, it is essential to distinguish them. This distinction may, however, be difficult to assess in some cases, as it has been reported that CML may be diagnosed initially with an isolated high platelet count with or without the expression of the Ph (Murphy et al, 1986; Morris et al, 1988; Stoll et al, 1988; Richards et al, 1993; Cervantes et al, 1996; Michiels & Juvonen, 1997). In general, the prognosis of these patients is identical to that of CML patients but, in some cases, survival is longer, suggesting a distinct entity (Richards et al, 1993). Furthermore, Ph-negative, bcr–ablpositive ET has been described (Tesch et al, 1990; Blickstein et al, 1997; Marasca et al, 1998; Yamada et al, 2000). The existence, the frequency, the clinical relevance and the prognosis of the latter entity remain controversial (Marasca et al, 1998; Hackwell et al, 1999; Sole et al, 2000). We
Correspondence: Dr G. Damaj, Institut Paoli Calmettes, 232 Avenue St Margueritte, Department of Haematology, Marseille 13009, France. E-mail:
[email protected]
812
Keywords: thrombocythaemia, bcr–abl, basophilia.
Ó 2002 Blackwell Science Ltd
Essential Thrombocythaemia and bcr–abl Transcript
813
therefore conducted a study in a large group of patients in order to determine whether bcr–abl transcript analysis could identify a particular group of ET.
hypotonic treatment and 3:1 methanol–acetic acid fixation. Chromosome analysis was carried out on R-banded preparations.
PATIENTS AND METHODS
RESULTS
Patients. ET patients from a single centre (Necker Hospital) were analysed who had been screened for the presence of the Ph and/or the bcr–abl transcript. At presentation, a detailed medical history and physical examination was followed by laboratory assessment including complete blood count and peripheral blood smears with differential leucocyte count, erythrocyte sedimentation rate and C-reactive protein or fibrinogen or a2 globulin; serum ferritin level and abdominal ultrasound were obtained. Diagnostic criteria of ET and other MPD. All patients were diagnosed according to the PVSG criteria for the diagnosis of ET (Murphy et al, 1986). Patients with immature myeloid cells in the peripheral blood, anisopoikylocytosis with teardrop erythrocytes, anaemia or circulating erythroblasts were excluded from the study (Barosi et al, 1999). Reverse transcription–polymerase chain reaction (RT– PCR). RNA extraction from Ficoll-separated peripheral blood mononuclear cells and reverse transcription were performed as described previously (Chomczynski & Sacchi, 1987; Poirel et al, 1995). An optimized multiplex PCR approach {a single 3¢ abl primer abl a3 (GTTTGGGCTTCACACCATTCC); and four 5¢ bcr primers, [bcr b1/e12 (GAAGTGTTTCAGAAGCTTCTCC), bcr e1 (ACTGCAGCTCCAATGAGAAC), bcr e6 (GACTTACCTGAGCCACCTGGAG), bcr c3/e19 (ACGGCGAGAGCACGG ACA)]} was used. Positive controls for this multiplex PCR were from K562 (P210, e14/a2), BV173 (P210, e13/a2), TOM1 (P190, e1/a2) and a diagnostic sample (P230, e19/a2). RNA quality was verified by a porphobilinogene desaminase (PBGD) RT–PCR as described previously (Poirel et al, 1995). The type of bcr– abl transcript was identified according to the size of RT–PCR product. Cytogenetic bone marrow study. Chromosome preparations were made from unstimulated bone marrow cultures prepared by standard techniques of COLCEMID incubation,
Between April 1974 and June 2000, 186 patients diagnosed with ET were retrieved from the registry of the outpatient clinic of the Haematology Department at the Hoˆpital Necker Enfants-Malades. After review of all cases, 65 patients were excluded from the study for incomplete medical record (n ¼ 37) or for the diagnosis of chronic myeloproliferative disease (n ¼ 18) other than ET. No cases were excluded only on the basis of bcr–abl positivity. Thus, a total of 121 patients who met the PVSG criteria for the diagnosis of ET were included in the study. bcr–abl-positive patients The bcr–abl transcript was detected in only two cases (2/121). The first patient was a 21-year-old-female when the diagnosis of ET was made. The presentation was characterized by mild hyperbasophilia (Table I). Bone marrow cytogenetics were normal at diagnosis. Hydroxyurea (HU) was introduced 10 years after the diagnosis, and the bcr–abl transcript was tested for the first time when myelofibrosis was diagnosed (11 years after the diagnosis) and found to be positive (b2a2). The patient died 12 years after diagnosis, from acute myeloid leukaemia (AML). Cytogenetic study at transformation was not available. The second patient was a 28-year-old female when she presented with features of typical ET but with basophilia (Table I). The Ph and bcr–abl (b3a2) were positive at diagnosis. HU was started after the diagnosis was made. After a 6-year follow-up period, the patient still has a normal white blood cell (WBC) count and does not exhibit any haematological features of underlying CML. bcr–abl- or Ph-negative patients Standard cytogenetic analysis was done on bone marrow samples at diagnosis in 18 patients. Bcr–abl transcript screening by RT–PCR on Ficoll-separated peripheral blood
Table I. Laboratory data at diagnosis of bcr–abl-negative and -positive groups.
Haematocrit (%) Leucocytes (· 109/l) PMNs (· 109/l) Eosinophils (· 109/l) Basophils (· 109/l) Lymphocytes (· 109/l) Monocytes (· 109/l) Platelets (· 109/l) Follow-up (months)
bcr–abl-negative group (n ¼ 119)
bcr–abl-positive group (n ¼ 2)
Median ± SD
Range
Patient 1
Patient 2
40Æ4 8Æ5 5Æ8 0Æ17 0Æ07 1Æ9 0Æ5 749 43
31–52 4Æ9–21Æ4 2Æ8–15 0–1Æ28 0–0Æ10 0Æ4–5Æ45 0–1Æ71 500–2380 0–309
41 11Æ6 8Æ6 0Æ46 0Æ23 1Æ6 0Æ7 990 140
40 12Æ9 4Æ95 0Æ1 0Æ42 2Æ5 0Æ40 1723 72
± ± ± ± ± ± ± ±
4Æ1 2Æ78 2Æ24 0Æ20 0Æ07 0Æ82 0Æ29 222
Ó 2002 Blackwell Science Ltd, British Journal of Haematology 116: 812–816
121
Present study
13
18 41 5
NA 112
40
25
BM
Cell origin
121
0 0 13
NA 0
4*
0
PB
Hypotonic lysis Ficoll
NA Lymphoprep separated NA
Ficoll
Ficoll
RNA extraction methods
Multiplex
Nested
Nested
Nested Nested
Nested
Nested
Type
RT–PCR
10–4 to 10–5
1 · 10)8
1Æ5
0 0 21
1 · 10–5
48
1 · 10)6 5 1
48
1Æ10)6
1 · 10–5 1 · 10–5
%
Sensitivity
NA NA b3a2 e1a2 b3a2 b2a2
b3a2 b2a2 b3a2 b2a2 b3a2 b3a2
Type
Positive bcr–abl transcript
*Three out of four patients positive in BM were negative in PB. Three patients who were negative in BM were positive in PB. àPlus two multiple myeloma. BM, bone marrow; PB, peripheral blood; MF, myelofibrosis; AL/MDS, acute leukaemia/myelodysplastic syndrome; NA, not available. 2 Update of1. 4Update of 3. 5FISH was used for the detection of bcr–abl rearrangement.
18 41 14
5
4
Hackwell et al (1999) Sole et al (2000) Yamada et al (2000)
40
25
20 112
Aviram et al (1999)
Blickstein et al (1997)
Marasca et al (1998) Emilia et al (2001)
3
2
1
References
ET patients (n)
Table II. Review of the literature.
1/2
NA NA NA
1/1 1/1
NA
NA
MF
0
NA NA NA
1/1 1/1
NA
NA
AL/MDS
Outcome Positive patients (n)
5/119
NA NA NA
1/19 3/111
NA
NA
MF
4/119
NA NA NA
0/19 2/111à
NA
NA
AL/MDS
Negative patients (n)
814 G. Damaj et al
Ó 2002 Blackwell Science Ltd, British Journal of Haematology 116: 812–816
Essential Thrombocythaemia and bcr–abl Transcript was done at diagnosis (n ¼ 87 patients) or after a median follow-up of 133 months (16–265 months; n ¼ 32 patients). A total of 119 patients failed to show rearrangement of the bcr–abl transcript. There were 41 males and 78 females with a median age of 54 years (17–91 years). The median platelet and WBC counts are shown in Table I. Seventeen (14Æ3%) patients had more than 12 · 109/l WBC, and 28 (23Æ5%) patients had more than 7Æ5 · 109/l polymorphonuclear cells (PMNCs). No excess of lymphocytes, eosinophils, basophils and monocytes was found in this group of patients. The spleen was palpable in 13 patients. After a median follow-up of 43 months (0–309 months), two patients developed acute leukaemia, both of which were t(9; 22) and bcr–abl negative. Seven other patients developed a myelodysplastic syndrome (n ¼ 2) and myelofibrosis (n ¼ 5). DISCUSSION The PVSG defined a number of stringent criteria necessary for the diagnosis of ET (Murphy et al, 1986). The absence of the Ph and/or the bcr–abl transcript is mandatory for diagnosis and may help in distinguishing ET from CML. However, it has recently been reported that the Ph can be found in a minority of ET (Morris et al, 1988; Martiat et al, 1989; LeBrun et al, 1991; Hashino et al, 1995; Michiels & Juvonen, 1997) estimated at 10% of patients (Stoll et al, 1988). In contrast to conventional ET, this entity is characterized by a poor prognosis, with death from evolution to either an accelerated or a blastic phase being observed in all patients with extended follow-up. Isolated RT–PCR detection of bcr–abl in ET has also been described. A review of the published literature (Table II) revealed two independent series (Aviram et al, 1999; Yamada et al, 2000), both based on nested PCR analysis, in which bcr– abl positivity was found in 21% and 48% of patients respectively (overall 22/54; 41%). In contrast, three studies did not identify a significant incidence of positive cases by nested RT–PCR (Hackwell et al, 1999; Emilia et al, 2001) or by fluorescence in situ hybridization (FISH) (Sole et al, 2000) (overall 3/292; 1% including our series). As described in Table II, the variable incidence of positivity does not appear to be related to the sensitivity of detection, although this might be expected to be an underlying cause, given the demonstration of low levels of bcr–abl in normal individuals (Biernaux et al, 1995; Bose et al, 1998); nor does it appear to be related to either blood vs. bone marrow analysis or the type of preanalytic cell selection (Ficoll vs. lysis, etc.). It is noteworthy that Aviram et al (1999) identified three patients who were positive in peripheral blood but not in the bone marrow. Our data are in keeping with a low incidence of bcr–abl in ET. Interestingly, both our positive cases were young females who exhibited mild hyperbasophilia at presentation. The course of the disease was relatively indolent, as reported previously (Richards et al, 1993; Hashino et al, 1995; Michiels & Juvonen, 1997). We were unfortunately unable to determine whether the bcr–abl was present at diagnosis or whether it appeared during disease progression. One of the two bcr–
815
abl-positive ET patients died 12 years after the diagnosis from myelofibrosis and AML, whereas in the bcr–ablnegative ET group, four patients transformed to MDS and AML, and five other subjects developed myelofibrosis (9/119; 7%). Our study represents the first large-scale analysis of ET using a multiplex RT–PCR approach capable of detecting all significant variant transcripts. Detection of e19-a2 transcripts is particularly relevant, as these patients tend to present with isolated neutrophilia and a relatively benign clinical course (Saglio et al, 1990; Pane et al, 1996; Wilson et al, 2000). Our results in this large group of patients are in agreement with other previous reports and confirm the absence of bcr–abl in typical ET. However, a subset of patients with ET and basophilia may express the transcript, and this may suggest the existence of a new entity with a clinical presentation and outcome intermediate between typical CML and ET. A prospective study of ET patients is warranted in order to define better the clinical and biological characteristics of this entity of bcr–ablexpressing ET. REFERENCES Aviram, A., Blickstein, D., Stark, P., Luboshitz, J., Bairey, O., Prokocimer, M. & Shaklai, M. (1999) Significance of BCR-ABL transcripts in bone marrow aspirates of Philadelphia-negative essential thrombocythemia patients. Leukemia and Lymphoma, 33, 77–82. Barosi, G., Ambrosetti, A., Finelli, C., Grossi, A., Leoni, P., Liberato, N.L., Petti, M.C., Pogliani, E., Ricetti, M., Rupoli, S., Visani, G. & Tura, S. (1999) The Italian Consensus Conference on diagnostic criteria for myelofibrosis with myeloid metaplasia. British Journal of Haematology, 104, 730–737. Biernaux, C., Loos, M., Sels, A., Huez, G. & Stryckmans, P. (1995) Detection of major bcr–abl gene expression at a very low level in blood cells of some healthy individuals. Blood, 86, 3118– 3122. Blickstein, D., Aviram, A., Luboshitz, J., Prokocimer, M., Stark, P., Bairey, O., Sulkes, J. & Shaklai, M. (1997) BCR–ABL transcripts in bone marrow aspirates of Philadelphia-negative essential thrombocytopenia patients: clinical presentation. Blood, 90, 2768–2771. Bose, S., Deininger, M., Gora-Tybor, J., Goldman, J.M. & Melo, J.V. (1998) The presence of typical and atypical BCR–ABL fusion genes in leukocytes of normal individuals: biologic significance and implications for the assessment of minimal residual disease. Blood, 92, 3362–3367. Cervantes, F., Colomer, D., Vives-Corrons, J.L., Rozman, C. & Montserrat, E. (1996) Chronic myeloid leukemia of thrombocythemic onset: a CML subtype with distinct hematological and molecular features? Leukemia, 10, 1241–1243. Chomczynski, P. & Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Analytical Biochemistry, 162, 156–159. Emilia, E., Marasca, R., Zucchini, P., Temperani, P., Luppi, M., Torelli, G., Lanza, F., De Angelis, C., Gandini, D., Castoldi, G.L., Vallisa, D., Cavanna, L. & del Senno, L. (2001) BCR–ABL rearrangement is not detectable in essential thrombocythemia. Blood, 97, 2187–2189. Hackwell, S., Ross, F. & Cullis, J.O. (1999) Patients with essential thrombocythemia do not express BCR–ABL transcripts. Blood, 93, 2420–2421.
Ó 2002 Blackwell Science Ltd, British Journal of Haematology 116: 812–816
816
G. Damaj et al
Hashino, S., Imamura, M., Kobayashi, S., Kunieda, Y. & Kobayashi, H. (1995) bcr–abl hybrid messenger RNA in a patient with Philadelphia-negative essential thrombocythemia. Acta Haematologica, 94, 52–54. LeBrun, D.P., Pinkerton, P.H., Sheridan, B.L., Chen-Lai, J., Dube, I.D. & Poldre, P.A. (1991) Essential thrombocythemia with the Philadelphia chromosome and BCR–ABL gene rearrangement. An entity distinct from chronic myeloid leukemia and Philadelphia chromosome-negative essential thrombocythemia. Cancer Genetics and Cytogenetics, 54, 21–25. Marasca, R., Luppi, M., Zucchini, P., Longo, G., Torelli, G. & Emilia, G. (1998) Might essential thrombocythemia carry Ph anomaly? Blood, 91, 3084–3085. Martiat, P., Ifrah, N., Rassool, F., Morgan, G., Giles, F., Gow, J. & Goldman, J.M. (1989) Molecular analysis of Philadelphia positive essential thrombocythemia. Leukemia, 3, 563–565. Michiels, J.J. & Juvonen, E. (1997) Proposal for revised diagnostic criteria of essential thrombocythemia and polycythemia vera by the Thrombocythemia Vera Study Group. Seminars in Thrombosis and Hemostasis, 23, 339–347. Morris, C.M., Fitzgerald, P.H., Hollings, P.E., Archer, S.A., Rosman, I., Beard, M.E., Heaton, D.C. & Newhook, C.J. (1988) Essential thrombocythaemia and the Philadelphia chromosome. British Journal of Haematology, 70, 13–19. Murphy, S., Iland, H., Rosenthal, D. & Laszlo, J. (1986) Essential thrombocythemia: an interim report from the Polycythemia Vera Study Group. Seminars in Hematology, 23, 177–182. Pane, F., Frigeri, F., Sindona, M., Luciano, L., Ferrara, F., Cimino, R., Meloni, G., Saglio, G., Salvatore, F. & Rotoli, B. (1996) Neutrophilic-chronic myeloid leukemia: a distinct disease with a specific molecular marker (BCR/ABL with C3/A2 junction). Blood, 88, 2410–2414. Poirel, H., Radford-Weiss, I., Rack, K., Troussard, X., Veil, A., Valensi, F., Picard, F., Guesnu, M., Leboeuf, D., Melle, J.,
Dreyfus, F., Flandrin, G. & Macintyre, E. (1995) Detection of the chromosome 16 CBF beta–MYH11 fusion transcript in myelomonocytic leukemias. Blood, 85, 1313–1322. Richards, E.M., Bloxham, D.M., Nacheva, E., Marcus, R.E. & Green, A.R. (1993) BCR rearrangement in apparent essential thrombocythaemia. British Journal of Haematology, 85, 625– 626. Saglio, G., Guerrasio, A., Rosso, C., Zaccaria, A., Tassinari, A., Serra, A., Rege-Cambrin, G., Mazza, U. & Gavosto, F. (1990) New type of Bcr/Abl junction in Philadelphia chromosomepositive chronic myelogenous leukemia. Blood, 76, 1819– 1824. Sole, F., Florensa, L., Espinet, B., Besses, C., Lloveras, E. & Woessner, S. (2000) Absence of bcr/abl rearrangement in 41 patients with essential thrombocythemia. Haematologica, 85, 214–215. Stoll, D.B., Peterson, P., Exten, R., Laszlo, J., Pisciotta, A.V., Ellis, J.T., White, P., Vaidya, K., Bozdech, M. & Murphy, S. (1988) Clinical presentation and natural history of patients with essential thrombocythemia and the Philadelphia chromosome. American Journal of Hematology, 27, 77–83. Tesch, H., Zankovich, R., Fonatsch, C. & Diehl, V. (1990) Analysis of bcr rearrangements in primary (essential) thrombocythaemia. Leukemia Research, 14, 241–246. Wilson, G.A., Vandenberghe, E.A., Pollitt, R.C., Rees, D.C., Goodeve, A.C., Peake, I.R. & Reilly, J.T. (2000) Are aberrant BCR–ABL transcripts more common than previously thought? British Journal of Haematology, 111, 1109–1111. Yamada, H., Murakami, T., Kaneda, T., Tadachi, M., Utsumi, M., Minami, S., Hamaguchi, M., Kasai, M., Kodera, Y., Ohashi, H., Morishita, Y., Terasawa, T., Yamasaki, Y., Kamiya, Y., Hattori, M., Yamanaka, K., Tsushita, K. & Shimoyama, M. (2000) Clinical significance of major and minor bcr/abl chimeric transcripts in essential thrombocythemia. Japanese Journal of Clinical Oncology, 30, 472–477.
Ó 2002 Blackwell Science Ltd, British Journal of Haematology 116: 812–816
