JOURNAL OF BACTERIOLOGY, June 2004, p. 3561–3569 0021-9193/04/$08.00⫹0 DOI: 10.1128/JB.186.11.3561–3569.2004 Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Vol. 186, No. 11
The Essential Nature of the Ubiquitous 26-Kilobase Circular Replicon of Borrelia burgdorferi Rebecca Byram,1,2 Philip E. Stewart,1 and Patricia Rosa1* Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Hamilton, Montana 59840,1 and Department of Molecular Biology, University of Wyoming, Laramie, Wyoming 820712 Received 22 December 2003/Accepted 9 February 2004
The genome of the type strain (B31) of Borrelia burgdorferi, the causative agent of Lyme disease, is composed of 12 linear and 9 circular plasmids and a linear chromosome. Plasmid content can vary among strains, but one 26-kb circular plasmid (cp26) is always present. The ubiquitous nature of cp26 suggests that it provides functions required for bacterial viability. We tested this hypothesis by attempting to selectively displace cp26 with an incompatible but replication-proficient vector, pBSV26. While pBSV26 transformants contained this incompatible vector, the vector coexisted with cp26, which is consistent with the hypothesis that cp26 carries essential genes. Several cp26 genes with ascribed or predicted functions may be essential. These include the BBB29 gene, which has sequence homology to a gene encoding a glucose-specific phosphotransferase system component, and the resT gene, which encodes a telomere resolvase involved in resolution of the replicated telomeres of the linear chromosome and plasmids. The BBB29 gene was successfully inactivated by allelic exchange, but attempted inactivation of resT resulted in merodiploid transformants, suggesting that resT is required for B. burgdorferi growth. To determine if resT is the only cp26 gene essential for growth, we introduced resT into B. burgdorferi on pBSV26. This did not result in displacement of cp26, suggesting that additional cp26 genes encode vital functions. We concluded that B. burgdorferi plasmid cp26 encodes functions critical for survival and thus shares some features with the chromosome. The spirochete Borrelia burgdorferi is the causative agent of Lyme disease, the most common vector-borne disease in the United States. B. burgdorferi is maintained in its natural setting through a complex enzootic cycle between mammals and an ixodid tick vector. In order to persist in the mouse-tick infectious cycle, B. burgdorferi has adapted for survival under very different conditions, the tick vector and the mammal host. B. burgdorferi has a segmented genome consisting of one linear chromosome that is ⬃911 kb long and 12 linear and 9 circular plasmids (3–5, 11, 16). The ends of the linear DNA molecules are composed of covalently closed hairpin inverted repeats or telomeres (4, 9, 10, 19, 21, 22). The functions of many of the plasmid-encoded genes have not been determined, but increasing evidence suggests that plasmid-derived functions are important for spirochete infectivity and transmission (27, 34, 41). For example, the 25-kb linear plasmid lp25 carries the pncA gene, which encodes a nicotinamidase that is required for spirochete survival in mice (33). In addition, strains lacking lp28-1, which contains the vmp-like sequence (VlsE) involved in antigenic variation, show reduced infectivity in mice (27, 34). Outer surface protein A (OspA), encoded by lp54, is upregulated in the tick midgut and is thought to play an important role in bacterial persistence in the vector (42–44). Finally, OspC is carried by the circular plasmid cp26. Spirochetes present in the midgut of an unfed tick express OspA. During tick feeding, the spirochetes begin downregulating OspA and expressing OspC (44), suggesting that OspC is im-
portant for vector-to-host transmission (13, 17, 18, 32, 42, 44, 45). Although B. burgdorferi plasmid-encoded functions are required for survival in the infectious cycle, loss of individual plasmids can be observed after limited in vitro propagation, and loss of most circular plasmids and all linear plasmids has been described for high-passage B. burgdorferi (39, 41). However, the loss of cp26 has never been observed, and this plasmid is present in all isolates that have been examined (11, 20, 29, 48), suggesting that it carries essential genes. A likely candidate for an essential gene present on cp26 is resT, which encodes a telomere resolvase involved in resolution of the replicated telomeres of the linear chromosome and plasmids (Fig. 1) (12, 24, 52). Another cp26 gene, BBB29, shows homology to a glucose-specific phosphotransferase system component (Fig. 1). Borrelia can obtain energy from the fermentation of glucose to lactic acid (16, 23), and the product of the BBB29 gene is presumably involved in transport of glucose into the cell. In this study we examined whether cp26 is required for cell viability by attempting to selectively displace this plasmid with an incompatible vector. Transformation with a presumably incompatible, but replication-proficient vector did not result in displacement of the endogenous cp26 plasmid, which is consistent with the hypothesis that cp26 carries essential genes. Subsequently, we attempted to inactivate the constituent BBB29 and resT genes to determine if the gene products are required for spirochete survival. Our findings suggest that resT is physiologically essential and that cp26, as previously proposed, encodes functions generally associated with a stable genomic element, like the chromosome (2, 24).
* Corresponding author. Mailing address: 903 S. 4th St., Hamilton, MT 59840. Phone: (406) 363-9209. Fax: (406) 363-9394. E-mail:
[email protected]. 3561
3562
BYRAM ET AL.
J. BACTERIOL.
FIG. 1. Graphic representation of the B. burgdorferi strain B31 cp26 plasmid. The approximate sizes and orientations of the 29 ORFs carried by cp26 are indicated. Genes on cp26 that exhibit homology to genes whose functions are known or that are of significant interest are labeled and indicated by arrows having different colors. Genes on cp26 whose functions are unknown are indicated by gray arrows. PTS, phosphotransferase system.
MATERIALS AND METHODS B. burgdorferi strains and growth conditions. All B. burgdorferi strains were cultivated in liquid BSK-H complete medium (Sigma) at 35°C with 1% CO2 (37). B31 clone A (B31-A) is a noninfectious derivative of type strain B31 (⫽ ATCC 35210), which was isolated from a tick collected on Shelter Island in New York (8). Construction of plasmids pBSV26, pBSV26G, and pBSV26resT2. The primer sequences used in this study were based on the previously described B31 genome sequence (16) and are shown in Table 1. A 3.4-kb region of cp26 homologous to the previously identified sequences required for plasmid autonomy (BBB10 to BBB13) (14, 46, 47) was amplified with primers 1 and 2 and cloned into the pCR-XL-TOPO vector (Invitrogen) by using the Expand Long Template PCR system (Roche Molecular Biochemicals). A fragment encompassing the BBB10BBB13 region was removed from pCR-XL-TOPO by SpeI digestion and ligated into the pOZK vector (47) digested with SpeI to obtain pBSV26. Briefly, the pOZK vector contains a kanamycin resistance cassette fused to the B. burgdorferi
flgB promoter that confers resistance in Borrelia and Escherichia coli, a zeocin resistance cassette, an E. coli origin of replication, and a multiple cloning site. The flgBP::aacC1 cassette conferring gentamicin resistance (15) was amplified with primers 8 and 13 and cloned into the pCR-XL-TOPO vector (Invitrogen) by using Taq DNA polymerase (New England Biolabs). The flgBP::aacC1 cassette was removed from pCR-XL-TOPO by XhoI digestion and ligated into pBSV26 digested with SalI to obtain pBSV26G. To create pBSV26resT, the resT gene was amplified with primers 3 and 4 and cloned into the TOPO-XL vector (Invitrogen) with a 347-bp 5⬘ flanking sequence by using the Expand Long Template PCR system (Roche). The resT fragment was subsequently removed from the TOPO-XL vector by SalI digestion and ligated into the multiple cloning site of the pBSV26 plasmid digested with SalI to obtain plasmid pBSV26resT. Construction of a resT inactivation plasmid. A 1.5-kb region of cp26 spanning the resT gene was amplified from B31-A genomic DNA with primers 3 and 4 and cloned into the pCR-XL-TOPO vector (Invitrogen) by using Taq polymerase
ESSENTIAL NATURE OF B. BURGDORFERI cp26 PLASMID
VOL. 186, 2004
3563
TABLE 1. Primers used in this study Primer
Designation
Sequence
Purpose
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
BBB10-13SpeI BBB10-13RCSpeI BBB03-5SalI BBB03-3BSalI ResT627-ClaI-RC ResT1002-ClaI-F FlgP-ClaI 3Gent-ClaI BBB29-5-2-Bam BBB29-3Bam BBB29-631SalIR BBB29-1100SalF flgBPo-XhoI KanTerm-Xho flgPo.Not
ACTAGTCTTACGGAGAAAAGGG ACTAGTGGATTAGAAGATTTAAGC GTCGACCCCAAATATATTGATAATGCC GTCGACGTATTTACCTTTATTAAAGCG CCATCGATTGGAGCAGACTGAGAATCTTACTAAA CCATCGATTTGAAAATAGGACTTCTCATCATTC ATCGATGAACTAATACCCGAGCTTCAAGGAG ATCGATGCGGATCTCGGCTTGAACG GGATCCCTGTGAAAAATCTAAAACCAACACCTTGC GGATCCGCAATGCTTTATAACAAATGCCATG GTCGACCAGTTGCAGCTGTTTCAGGC GTCGACGCAGATCCCAATACTG TAATACTCGAGCTTCAAGGAAGATTT ATCTCGAGCTAGCGCCGTCCCGTCAA GCGGCCGCTACCCGAGCTTCAAGGAAGATT
16
RC.Tkan
GCGCCGTCCCGTCAAGTC
Construction of pBSV26 Construction of pBSV26 Construction of pBSV26resT Construction of pBSV26resT resT inactivation construct resT inactivation construct Amplification of flgBP::aacC1 Amplification of flgBP::aacC1 BBB29 inactivation construct BBB29 inactivation construct BBB29 inactivation construct BBB29 inactivation construct Amplification of flgBP::kan Amplification of flgBP::kan Examination of B. burgdorferi transformants Examination of B. burgdorferi transformants
(Perkin-Elmer). A 375-bp deletion in the resT gene from nucleotide 627 to nucleotide 1002 was constructed by using primers 5 and 6 in an inverse PCR performed with the Expand Long Template PCR system (Roche) to create plasmid XL-resT⌬627-1002. The flgBP::aacC1 (15) gene cassette was amplified with primers 7 and 8 and cloned into the TOPO-pCR2.1 vector (Invitrogen) with Taq polymerase (New England Biolabs). The flgBP::aacC1 gene cassette was removed from the TOPO-pCR2.1 vector by ClaI digestion and ligated into XL-resT⌬627-1002 digested with ClaI to create plasmid XL-resT⌬627-1002::flgBP::aacC1. Construction of a BBB29 inactivation plasmid. A 2.4-kb region of cp26 that included the full-length BBB29 gene was amplified from B31-A genomic DNA with primers 9 and 10 and cloned into the pCR-XL-TOPO vector (Invitrogen) by using Taq polymerase (Perkin-Elmer). A 469-bp deletion in the BBB29 gene from nucleotide 631 to nucleotide 1100 was constructed by an inverse PCR by using the Expand Long Template PCR system (Roche) and primers 11 and 12 to create plasmid XL-BBB29⌬631-1100. The flgBP::kan (6) gene cassette was amplified with primers 13 and 14 and cloned into the TOPO-pCR2.1 vector (Invitrogen) with Taq polymerase (New England Biolabs). The flgBP::kan gene cassette was removed from the TOPO-pCR2.1 vector by XhoI restriction enzyme digestion and ligated into XL-BBB29⌬631-1100 digested with SalI to create plasmid XL-BBB29⌬631-1002::flgBP::kan. Transformation of B. burgdorferi. Transformation of B. burgdorferi by electroporation was performed as described by Elias et al. (15). Briefly, 10 g of plasmid DNA was resuspended in 10 l of H2O and electroporated into B. burgdorferi. Following electroporation, the cells were resuspended in 5 ml of BSK-H complete medium (Sigma) and allowed to recover for 20 to 24 h at 35°C. The spirochetes were then plated onto solid BSKII medium supplemented with either 200 g of kanamycin ml⫺1 or 40 g of gentamicin ml⫺1 (40). Screening of B. burgdorferi transformants. B. burgdorferi colonies that arose on selective media containing antibiotics were inoculated into 20-l PCR mixtures with sterile toothpicks. PCR performed with primers specific for the kanamycin cassette (primers 15 and 16) was used to identify shuttle vector transformants. Allelic exchange transformants were first screened for the presence of the kanamycin resistance cassette (BBB29 inactivation) by using primers 15 and 16 or for the presence of the gentamicin resistance cassette (resT inactivation) by using primers 7 and 8. Transformants bearing the kanamycin resistance cassette were screened for inactivation of the BBB29 gene with primers 9 and 10. Transformants containing the gentamicin antibiotic resistance cassette were screened for inactivation of the resT gene with primers 3 and 4. The PCR conditions were 94°C for 2 min, followed by 30 cycles of 94°C for 45 s, 55°C for 45 s, and 68°C for 3 min in a GeneAmp PCR system 9700 thermal cycler (Perkin-Elmer). PCR products were separated by agarose gel electrophoresis and were visualized by ethidium bromide staining. Colonies of candidate transformants were aspirated with a sterile Pasteur pipette, placed in 5 ml of liquid BSK-H medium (Sigma), and allowed to grow to the mid-log to late log phase. Total genomic DNA was then isolated from these cultures with a Wizard genomic DNA purification kit (Promega). PCR performed with total genomic DNA by using primers specific for the shuttle vectors or cp26 genes was used to further confirm the presence of foreign DNA or the structure of targeted loci in transformants.
Southern hybridization analysis. Total genomic DNA of B. burgdorferi was isolated from 5-ml cultures by using a Wizard genomic DNA purification kit (Promega). In addition, B. burgdorferi plasmid DNA was isolated from 100-ml cultures by using a Qiagen Plasmid Hi-Speed maxi kit (Qiagen). Approximately 600 ng of genomic DNA or 500 ng of plasmid DNA was separated by gel electrophoresis on a 0.3% agarose gel and visualized by ethidium bromide staining. Alternatively, approximately 500 ng of DNA was digested for 12 to 20 h with selected restriction enzymes and subsequently separated by field inversion gel electrophoresis on a 0.8% agarose gel. The gels were electrophoresed at 80 V for 40 min, and then program 3 (reverse, 0.05 to 1.601; forward, 0.15 to 4.803; one cycle, 2 min 3.9 s) was begun with an MJ Research PPI-200 programmable power inverter at 80 V for 22 h. Genomic or plasmid DNA was depurinated, denatured, and neutralized, and then it was blotted onto a Biotrans nylon membrane (ICN). A UV Stratalinker 1800 (Stratagene) was used to cross-link the DNA to the membrane. The kan-, aacC1-, and cp26-specific probes were labeled with 32P by using the Random Primers DNA labeling system (Invitrogen) according to the manufacturer’s recommendations. Prehybridization was done at 65°C for 2 h in 50 ml of Blotto solution (6⫻ SSC, 0.1% sodium dodecyl sulfate [SDS], 0.5% nonfat dry milk, 1 mM sodium pyrophosphate [1⫻ SSC is 0.15 M NaCl plus 0.015 M sodium citrate]). Hybridization was performed at 65°C in 30 ml of Blotto solution for 32 to 48 h. The washes, all of which were at 65°C for 10 to 12 min, consisted of one wash in 2⫻ SSC–0.1% SDS, followed by three washes in 0.2⫻ SSC–0.1% SDS. The membrane was then placed in an X-ray film cassette and exposed to X-ray film with an intensifier screen for various amounts of time. Probes were stripped from membranes by boiling the membranes in 0.1% SDS for 45 min. Stability assays. B. burgdorferi transformants were grown in the presence or absence of the antibiotic for which they carried a resistance cassette. Transformants were grown to the mid-log phase (5 ⫻ 107 to 9 ⫻ 107 bacteria ml⫺1) in 5 ml of BSK-H medium (Sigma) at 35°C. At each passage, cultures were inoculated at a starting concentration of ⬃1.0 ⫻ 104 spirochetes ml⫺1 and grown to the mid-log phase. Each passage represented ⬃13 generations (8 ⫻ 10⫺3 dilution). Cells were counted by dark-field microscopy with a Petroff-Hauser counting chamber before each passage. Cultures were plated at different points during in vitro passage, and 20 colonies from each culture were screened by PCR to determine the presence of the relevant antibiotic resistance cassettes.
RESULTS Attempted displacement of cp26 through introduction of an incompatible plasmid. The circular plasmid cp26 is present in all isolates of B. burgdorferi that have been examined, and there have been no reports of loss of this plasmid during in vitro growth. Because spontaneous loss of cp26 has not been observed, we hypothesized that an incompatible plasmid could coexist with, rather than displace, endogenous cp26. Plasmid
3564
BYRAM ET AL.
J. BACTERIOL. TABLE 2. Transformation frequencies of B. burgdorferi strains Plasmid
pBSV2 pBSV26 pBSV26 rescued DNA
Transformation frequencya B31-A (naı¨ve) ⫺6
1.4 ⫻ 10 6.8 ⫻ 10⫺6 8.1 ⫻ 10⫺6
B31-A (cured of pBSV26)
1.2 ⫻ 10⫺3 8.4 ⫻ 10⫺5 ⫾ 9.5 ⫻ 10⫺5 NDb
a The transformation frequency was calculated by determining the ratio of the number of transformants to the number of CFU as determined by growth of the electroporated culture on selective and nonselective media. b ND, not determined.
mation frequency of pBSV26 in high-passage B31-A was 6.8 ⫻ 10⫺6, which is similar to the transformation frequency obtained when the previously characterized shuttle vector pBSV2 was transformed into the same B. burgdorferi strain (1.4 ⫻ 10⫺6) (Table 2). In order to determine if pBSV26 had displaced the endogenous cp26 plasmid or coexisted with it, the same pBSV26 transformants were screened by PCR for sequences unique to cp26. A cp26 PCR product was obtained from all pBSV26 transformants (data not shown), suggesting that pBSV26 coexisted with the endogenous cp26 plasmid. Southern blot analysis of undigested genomic DNA was performed to confirm the presence of cp26 in pBSV26 transformants (Fig. 3A). DNA species consistent with a supercoiled, autonomously replicating plasmid hybridized with the kan probe in three of six pBSV26 transformants examined (Fig. 3A, lanes 6 to 8). In the remaining three transformants, the kan
FIG. 2. (A) Shuttle vector derived from cp26 (pBSV26). (B) cp26derived shuttle vector carrying the resT gene (pBSV26resT). Relevant restriction sites are indicated. ColE1, E. coli origin and replication; ZEO, zeocin resistance marker; flgBp::kan, kanamycin resistance marker fused to the flgB promoter (6).
incompatibility occurs when two plasmid species with identical replication and/or partitioning functions compete, culminating in loss of one of the plasmids (1). Similarly, a 3.3-kb region of the cp9 plasmid of B. burgdorferi sufficient for autonomous replication has been identified and used to create Borrelia shuttle vector pBSV2 (47). This shuttle vector displaces cp9 due to plasmid incompatibility. In addition, vectors carrying paralogous regions of other B. burgdorferi plasmids have been demonstrated to be sufficient for autonomous replication and to displace the endogenous plasmids from which they were derived, demonstrating that incompatibility functions are also conferred by these open reading frames (ORFs) (14, 46, 47). Therefore, we constructed a vector, designated pBSV26, composed of a 3.4-kb region of cp26 encoding four tandem ORFs that exhibit homology with the previously identified sequences required for plasmid replication and incompatibility (14, 46, 47) (Fig. 2A). Displacement of the endogenous cp26 plasmid was attempted by transforming clone B31-A with pBSV26; multiple pBSV26 transformants were confirmed by PCR screening of colonies for the kanamycin resistance cassette. The transfor-
FIG. 3. Southern blot analysis of B. burgdorferi pBSV26 transformants. Wild-type B. burgdorferi DNA (lane 1), pBSV26 plasmid DNA isolated from E. coli (lane 2), and pBSV26 B. burgdorferi transformant DNA (lanes 3 to 8) were used. (A) Southern blot of genomic DNA was first probed with the kanamycin resistance gene. (B) Southern blot of genomic DNA was stripped and then probed with the cp26 gene ospC. An asterisk indicates the position of the endogenous, supercoiled form of cp26, while a solid square indicates the position of the supercoiled, extrachromosomal shuttle vector. A solid circle indicates the position of the supercoiled cp26 with the pBSV26 integrant, and a solid triangle indicates the position of the supercoiled cp26 dimer with the pBSV26 integrant. Unmarked higher-molecular-weight bands are linear forms of the circular plasmid that were a result of plasmid DNA preparation. The positions of DNA size standards (in kilobases) are indicated on the left.
VOL. 186, 2004
ESSENTIAL NATURE OF B. BURGDORFERI cp26 PLASMID
probe hybridized to larger DNA species, which is consistent with integration of pBSV26 into a cp26 monomer (Fig. 3A, lanes 3 and 4) or dimer (Fig. 3A, lane 5). The blot was then stripped and probed with ospC in order to visualize cp26 (Fig. 3B). A band that comigrated with the endogenous cp26 plasmid of B31-A (Fig. 3B, lane 1) was present in three of six transformants examined (Fig. 3B, lanes 6 to 8), whereas a slightly larger band, which also hybridized to the kan probe, was present in the remaining transformants (Fig. 3B, lanes 3 to 5). These results suggest that pBSV26 either autonomously replicates within borreliae (Fig. 3B, lane 6 to 8) or integrates into a cp26 monomer (Fig. 3B, lanes 3 and 4) or dimer (Fig. 3B, lane 5). Two of six transformants examined represented a mixed cp26 population (Fig. 3B, lanes 6 and 7), in which pBSV26 both replicated autonomously and integrated into the endogenous cp26 plasmid. Thus, in all cases pBSV26 coexisted with the endogenous cp26 plasmid, suggesting that cp26 cannot be displaced by an incompatible plasmid. Stability of the pBSV26 vector. Due to plasmid incompatibility, we speculated that an autonomously replicating form of pBSV26 would be lost within a population if selection were removed. In order to determine the stability of pBSV26 in B. burgdorferi, transformants with autonomously replicating (Fig. 3, lanes 8) and integrated (Fig. 3, lanes 3) forms of pBSV26 were serially passaged with or without kanamycin selection. The cultures were plated after 35 and 70 generations, and the resulting colonies were examined by PCR screening for the presence of pBSV26. All 20 colonies of B. burgdorferi carrying the integrated form of pBSV26 retained the plasmid sequences after 70 generations, both with and without kanamycin selection. With kanamycin selection, all 20 colonies derived from the autonomously replicating form of pBSV26 retained the vector after 35 generations, whereas when kanamycin selection was not present, none of the 20 colonies derived from the same clone contained pBSV26 sequences. Southern blot analysis was performed with uncut genomic DNA from pBSV26 transformants after in vitro passage with kanamycin to determine if pBSV26 was still replicating autonomously after 35 generations of growth (data not shown). Both the kan and ospC probes hybridized to a large DNA species consistent with a pBSV26 integrant. Thus, after 35 generations of growth with selection, pBSV26 was stably maintained in the genome by integration into the cp26 plasmid. We conducted the following experiments to determine if mutations arose in either cp26 or pBSV26 that permitted coexistence of the two plasmids in the same cell. A B. burgdorferi clone that had been cured of pBSV26 (by passage without antibiotic selection) was retransformed with pBSV26. In addition, pBSV26 rescued from B. burgdorferi was retransformed into naı¨ve spirochetes. The transformation frequencies were different in different experiments, but they were similar to those obtained previously with pBSV26 (Table 2). We concluded that cp26 and pBSV26 are incompatible plasmids that coexist within transformants because of inherent (cp26) and imposed (pBSV26) selective pressures and that mutations that enhanced compatibility did not arise in either plasmid. Surprisingly, transformation with control plasmid pBSV2 into cured B31-A was ⬃1,000-fold higher than transformation with control plasmid pBSV2 into naı¨ve B31-A (Table 2). The basis for this stimulation of transformation is unknown, but the data
3565
do not suggest that a mutation arose in cp26 because pBSV2 was derived from an unrelated plasmid, cp9, and transformation with pBSV26 was not stimulated to a similar extent. Since pBSV26 did not displace cp26, we asked whether the cp26 sequences present on the shuttle vector actually cause incompatibility. To examine this question, we constructed a closely related shuttle vector, pBSV26G, which carried the same cp26 sequences as pBSV26 but a different selectable marker (a gentamicin resistance cassette). Electroporation of pBSV26G into a B. burgdorferi clone that contained an autonomously replicating pBSV26 plasmid (kanamycin resistant) resulted in multiple gentamicin-resistant transformants. In order to determine if pBSV26G had displaced pBSV26, transformants were screened by using a primer internal to the B. burgdorferi cp26 sequences together with a primer for the gentamicin resistance cassette (pBSV26G) or the kanamycin resistance cassette (pBSV26). With all transformants, we obtained a PCR product that was consistent with the sole presence of gentamicin-resistant pBSV26G (data not shown). In addition, only gentamicin-resistant E. coli colonies containing pBSV26G arose when plasmids were rescued from B. burgdorferi transformants (data not shown). We concluded that pBSV26G displaces pBSV26, demonstrating that incompatibility features are present in the cp26 sequences carried by these plasmids. Putative essential elements of cp26. The finding that cp26 is not displaced by an incompatible plasmid is consistent with the hypothesis that cp26 encodes essential functions. To examine particular cp26 genes required for in vitro growth, genes encoding a telomere resolvase, resT (24), and a homolog of a glucose transporter component, BBB29 (16), were targeted for inactivation by allelic exchange. Recovery of mutants in which these genes were inactivated would demonstrate that they are not essential for in vitro growth, whereas inactivation of essential genes would result in a lethal phenotype. Inactivation of BBB29 by allelic exchange was attempted by transformation of B31-A with plasmid XL-BBB29⌬ (Fig. 4A). PCR products consistent with an allelic exchange event were obtained when transformants were screened with primers specific for the BBB29 gene (data not shown). Southern blot analysis of transformants digested with selected restriction enzymes was performed to confirm gene inactivation. DNA species consistent with an inactivated BBB29 gene were observed when the blot was probed with the kan cassette (data not shown). BBB29 mutants were viable in vitro, although the doubling time was slightly longer than that of the wild type. Thus, inactivation of BBB29 by allelic exchange demonstrated that the gene product is not required for B. burgdorferi growth in vitro. Inactivation of the resT gene by allelic exchange was attempted in B31-A with plasmid XL-resT⌬ (Fig. 4B). When transformants were screened by PCR with primers specific for the resT gene, products consistent with both wild-type and mutant resT were obtained (data not shown). These results suggested that the XL-resT⌬ transformants contained two alleles of resT, wild-type and mutant, and were diploid at this locus (referred to as merodiploid below). Southern blot analysis of plasmid DNA from an XL-resT⌬ transformant digested with BglI (which linearized cp26) or NcoI and SpeI (which cut within resT flanking sequences) was performed to confirm the
3566
BYRAM ET AL.
FIG. 4. Targeted inactivation of BBB29 and resT. (A) Organization of BBB29 and flanking genes on cp26. Also shown are the deletion of 469 bp of BBB29 and insertion of the kanamycin resistance cassette. The small arrows indicate the cp26 fragment used in the allelic exchange construct for inactivation of BBB29. (B) Organization of resT and flanking genes on cp26. Also shown are the deletion of 375 bp of resT and the insertion of the gentamicin resistance cassette (flgBP::aacC1). Relevant restriction sites are indicated. The small arrows indicate the cp26 fragment used in the allelic exchange construct for inactivation of resT.
merodiploid nature of the resT mutants (Fig. 5). An inactivated copy of resT was observed in transformant DNA digested with NcoI and SpeI and probed with the gentamicin resistance cassette (aacC1) (Fig. 5A, lane tx-NcoI/SpeI). Additionally, a DNA species consistent with a wild-type copy of resT was observed in both the parent (Fig. 5B, lane wt-NcoI/SpeI) and the transformant (Fig. 5B, lane tx-NcoI/SpeI) DNA digested with NcoI and SpeI when the blot was stripped and reprobed with resT. No noticeable difference in the size of linearized cp26 was observed between the transformant and wild type, suggesting that the plasmid carrying the allelic exchange construct had not integrated into cp26 (Fig. 5B, lanes wt-BglI and tx-BglI3). Thus, the XL-resT⌬ transformants were merodiploid, carrying both a wild-type copy and a mutant copy of resT. Therefore, inactivation of resT did occur via allelic exchange, but a wild-type copy of resT was always present, supporting the hypothesis that telomere resolvase is essential for B. burgdorferi growth. Stability of mutant resT plasmid. Because XL-resT⌬ transformants were merodiploid for resT, we speculated that the stability of a cp26 monomer carrying an inactivated copy of resT would be compromised. In contrast, dimers of cp26 have also been described previously and are stable during in vitro passage (51). We hypothesized that if allelic exchange occurred at one of two resT loci on a cp26 dimer, a B31-A resT⌬ transformant would maintain the inactivated copy of resT throughout many generations. To test this hypothesis, two B31-A
J. BACTERIOL.
FIG. 5. Southern blot analysis of transformants with a resT inactivation construct. Wild-type B. burgdorferi (wt) and XL-resT⌬ transformant (tx) plasmid DNA were digested with BglI, which cut once within cp26 and linearized the plasmid, and with NcoI and SpeI, whose restriction sites flanked the resT gene. (A) The blot was first probed with the gene that confers gentamicin resistance, aacC1. (B) The same blot was stripped and then probed with the resT gene. The positions of NcoI and SpeI fragments corresponding to the mutant and wild-type copies of resT are indicated. The positions of DNA size standards (in kilobases) are indicated on the left.
resT⌬ transformants (clones A and B) were serially passaged with or without gentamicin selection. The cultures were plated after 26 and 52 generations, and the resulting colonies were screened for the presence of the aacC1 cassette. All 20 colonies derived from both B31-A resT⌬ transformants retained the mutant copy of resT when they were passaged with gentamicin selection. Southern blot analysis was performed with uncut and NcoI/SpeI-digested genomic DNA from B31-A resT⌬ clones A and B before serial passage, with and without antibiotic selection. In transformant clone A, cp26 was present in the monomer form, whereas cp26 of transformant clone B was present as a dimer (data not shown). When B31-A resT⌬ clone A was passaged without selection, only 3 of 20 (15%) of the colonies after 26 generations and none of the 20 colonies after 52 generations contained the mutant copy of resT. In contrast, all 20 of the colonies derived from B31-A resT⌬ clone B contained the mutant copy of resT after 52 generations. Thus, the merodiploid nature of XL-resT⌬ transformants can be explained by recombination of resT⌬ into one copy of resT on a cp26 dimer or by allelic exchange at the resT locus of one of several coexisting cp26 monomers.
VOL. 186, 2004
ESSENTIAL NATURE OF B. BURGDORFERI cp26 PLASMID
3567
further suggests that cp26 encodes crucial functions in addition to resT. DISCUSSION
FIG. 6. Southern blot analysis of pBSV26resT transformants. Wildtype B. burgdorferi DNA (lane 1), pBSV26resT plasmid DNA isolated from E. coli (lane 2), and pBSV26resT transformant DNA (lanes 3 to 8) were used. (A) Southern blot of genomic DNA was first probed with the kanamycin resistance gene. (B) The same Southern blot was stripped and then probed with the cp26 gene ospC. An asterisk indicates the position of the endogenous, supercoiled form of cp26, while a solid square indicates the position of the supercoiled, extrachromosomal shuttle vector pBSV26resT. A solid circle indicates the position of the supercoiled cp26 monomer with a pBSV26resT integrant, and a solid triangle indicates the position of a cp26 dimer with a pBSV26resT integrant. Unmarked higher-molecular-weight bands are linear forms of the circular plasmid that were a result of plasmid DNA preparation. The positions of DNA size standards (in kilobases) are indicated on the left.
Attempted displacement of cp26 through introduction of a plasmid carrying resT. We were not able to eliminate resT by allelic exchange, which is consistent with the hypothesis that telomere resolution is required for B. burgdorferi growth. To determine if resT is the sole cp26 gene that encodes a critical function, we cloned resT in pBSV26 and examined whether the construct was sufficient to displace cp26. The resT gene with 347 bp of 5⬘ flanking sequence was cloned into the multiple cloning site of pBSV26 to create plasmid pBSV26resT (Fig. 2B). Displacement of the endogenous cp26 plasmid was attempted by transforming clone B31-A with pBSV26resT; 67 transformants were confirmed by PCR screening of colonies for the presence of the kanamycin resistance cassette. To investigate if pBSV26resT had displaced the endogenous cp26 plasmid or coexisted with cp26, the transformants were screened by PCR for the presence of the ospC gene, which is carried by cp26. PCR products of the predicted size were obtained for all 67 pBSV26resT transformants (data not shown), suggesting that endogenous cp26 was still present after transformation with pBSV26resT. A Southern blot of pBSV26resT transformants was probed for the kan gene (Fig. 6A), stripped, and then probed for ospC (Fig. 6B), and the results were similar to those seen with pBSV26 transformants. The pBSV26resT plasmid either autonomously replicated with cp26 or had integrated into cp26 (Fig. 6). Thus, pBSV26resT coexisted with, but was not sufficient to displace, cp26, which
The B. burgdorferi circular plasmid cp26 is present in all natural isolates; it has never been observed to be lost during in vitro growth, and it cannot be displaced by an incompatible plasmid. These findings argue that cp26 encodes gene products required for spirochete survival, such as the telomere resolvase, ResT. The ResT enzyme resolves the replicated telomeres of both the linear chromosome and the linear plasmid DNA molecules (24). As demonstrated in this study, cp26 genes other than resT also may be required for in vitro growth, because a cp26-based shuttle vector carrying the resT gene was not sufficient to displace the endogenous plasmid. However, the identities of additional cp26 genes crucial for in vitro growth remain to be determined. Alternatively, the resT gene on pBSV26 may not be adequately expressed and thus may be incapable of displacing the endogenous resT gene on cp26. Of the 29 ORFs present on cp26, 14 exhibit sequence homology with genes whose functions are known. The proportion of recognizable genes carried by cp26 is quite large compared to the proportion of recognizable genes carried by other plasmids in the B. burgdorferi plasmid genome. By comparison, linear plasmid lp25, which is approximately the same size as cp26, carries only two genes (in addition to the genes required for plasmid maintenance) that have been characterized and exhibit sequence homology with genes whose functions are known (16, 33). The pncA gene (BBE22) encodes a nicotinamidase, and the BBE02 gene exhibits sequence homology to a gene encoding a restriction-modification system (16, 28, 33). Of the 14 cp26 genes with proposed functions, the BBB10 (paralogous family [pf] 62), BBB11 (pf 50), BBB12 (pf 32), and BBB13 (pf 49) genes belong to paralogous gene families involved in plasmid replication and partitioning (11) (Fig. 1). Shuttle vectors containing these sequences from other B. burgdorferi plasmids replicate autonomously in borreliae and displace the plasmid from which they were derived, suggesting that both replication and partitioning functions, as well as incompatibility, are conferred by these gene families (14, 46, 47). Additionally, shuttle vectors composed of these cp26 genes but carrying different antibiotic resistance markers displace each other, which is consistent with plasmid incompatibility functions. Based on frequencies of transformation into a cured strain or with a rescued plasmid, we concluded that no mutations had arisen in cp26 or pBSV26 that enhanced the compatibility of the two plasmids in the same cell. Interestingly, we observed that transformation with the control plasmid, pBSV2, was ⬃1,000-fold higher into a B31-A strain cured of pBSV26 than into naı¨ve B31-A. Transformation of B. burgdorferi is influenced by many factors and can vary with each experiment (28, 49), and although the data are intriguing, the basis for this stimulation of transformation is not understood. Proposed or known functions have also been determined for chbC (50), oppAIV (7), and guaB (30, 51, 53) (Fig. 1), all of which have been successfully inactivated without inhibition of in vitro growth. The BBB29 gene exhibits significant sequence homology to a glucose-specific phosphotransferase system component and thus is hypothesized to be important for B.
3568
J. BACTERIOL.
BYRAM ET AL.
burgdorferi survival. However, inactivation of the BBB29 gene by allelic exchange occurred, and BBB29 mutants displayed only a slight growth defect during in vitro cultivation. The function of the BBB29 gene product is most likely redundant since this gene product exhibits significant amino acid similarity (53%) with the product of the BB0645 gene present on the chromosome, which is also homologous to a glucose-specific phosphotransferase system component (16). It is also possible that B. burgdorferi can utilize other carbohydrates as alternatives to glucose, since genes with homology to fructose, maltose, glucosamine, and glycerol transporter components have been identified in the genome (16). Although not previously recognized (16), the products of the BBB22 and BBB23 genes present on cp26 exhibit amino acid homology to a family of guanine-xanthine transporters. The BBB22 and BBB23 genes are quite similar and may represent a gene duplication event. The remaining 13 genes present on cp26 do not exhibit significant sequence homology with genes whose functions are known and are uncharacterized. The B. burgdorferi clone B31-A used in this study is a noninfectious derivative of type strain B31. Although clones that are mutated at a cp26 locus do not display a noticeable growth phenotype when they are cultivated in vitro, the effect that such mutations would have on spirochete viability in vivo cannot be examined until mutations are introduced into an infectious clone. A cp26 gene that encodes a putatively critical function is resT, which encodes the telomere resolvase. ResT catalyzes resolution of the replicated telomeres and generates the hairpin ends on the linear chromosome and plasmids of B. burgdorferi in the absence of any accessory proteins or cofactors (24, 52). There are no other candidates for a telomere resolvase gene in the B. burgdorferi genome (16, 24). Hence, ResT is presumably required for effective replication of linear DNA molecules, which include the chromosome. The resT gene exhibits sequence homology to the gene encoding TelN, which resolves the replicated telomeres of the linear coliphage N15 (12, 24, 35, 36, 38). An N15 derivative in which the telN gene had been inactivated was not maintained in daughter cells unless a functional telN gene was provided in trans (36). Similar to the situation in N15, inactivation of the B. burgdorferi resT gene was not possible and resulted in merodiploid transformants carrying both a mutant and wild-type copy of resT. The inability to recover a resT mutant was probably due to the requirement for the gene product to resolve linear chromosomal and plasmid replication intermediates. This provides a limited explanation for why cp26, which carries resT, cannot be lost. A caveat to this conclusion, however, is that the data are circumstantial, albeit convincing. More definitive proof of the essential nature of cp26 and the function of ResT awaits the ability to create a conditional ResT mutant, a genetic tool not currently available for B. burgdorferi. The copy number of B. burgdorferi plasmids is not clearly defined; however, Hinnebusch and Barbour (20) concluded that the copy number of cp26 in the cell is equivalent to the copy number of the chromosome. Morrison et al. (31), using quantitative PCR, concluded that the copy number of the B. burgdorferi chromosome is approximately one copy per cell. Thus, the copy number of cp26 is presumably also approximately one copy per cell. We demonstrated that antibiotic selection, coupled with the pressure to maintain a functional
copy of an important gene (resT), results in a B. burgdorferi merodiploid, whose copy number may deviate slightly from the normal copy number. This genotype was maintained in different forms. In some transformants, it appeared that two distinct cp26 monomers were present in individual bacteria, whereas in other transformants, cp26 was present as a heterozygous dimer. The occurrence of cp26 dimers has been described previously by Tilly et al. (51), and the dimers were shown to be ⬃90% stable for up to 120 generations. Thus, B. burgdorferi naturally has at least two copies of every cp26 gene, including resT, when cp26 exists as a dimer in the cell. The cp26 plasmid likely encodes at least one essential function, so has it been misrepresented as a plasmid when it is truly a minichromosome? A plasmid is defined as an autonomously replicating DNA molecule that encodes nonessential functions (26). In contrast, a bacterial chromosome is a genetic element that is necessary, as well as sufficient, to support bacterial growth (25). Telomere resolution encoded by cp26 is no doubt required for replication of both the linear chromosome and linear plasmids, and therefore cp26 is necessary, but not sufficient, for growth of the organism. Conversely, the B. burgdorferi plasmids presumably require chromosomally encoded replication proteins, such as DNA polymerase. Thus, the B. burgdorferi linear chromosome and cp26 are both required for maintenance of the bacterial genome. Therefore, it appears that the B. burgdorferi genome does not have a single genetic element that entirely fits the definition of a chromosome, but it contains multiple genomic segments that together are necessary and sufficient for bacterial growth. The fact that cp26 is absolutely required for bacterial growth differentiates this circular genetic element from at least most of the remaining B. burgdorferi plasmids. B. burgdorferi variants that contain cp26 but lack all linear plasmids have been described previously (39). It has been demonstrated that some linear plasmids are required for B. burgdorferi survival during at least part of the in vivo spirochete life cycle. For instance, the lp25 plasmid is essential for growth within a mammal host (33, 34), yet it is rapidly lost during in vitro growth (41). Thus, although it is required in a defined niche during the B. burgdorferi life cycle, lp25 is an expendable genetic element and fits the definition of a plasmid in vitro, whereas cp26 is never lost and encodes essential biochemical functions. We concluded that cp26 encodes functions critical to bacterial viability, including telomere resolution, and thus is a ubiquitous and stable component of the B. burgdorferi genome. Future studies will be directed at investigating which additional genes on cp26 are important for bacterial survival and the contributions of these genes to basic cellular processes. The functions of genes carried by cp26 and the universal presence of cp26 in the segmented B. burgdorferi genome argue that this element is more analogous to a chromosomal fragment than to a plasmid. ACKNOWLEDGMENTS We thank Anita Mora and Gary Hettrick for graphic assistance, Gail Sylva and Sandra Raffel for technical assistance, and Greg Somerville, Izabela Sitkiewicz, and Robert Heinzen for critical evaluation of the manuscript. We also thank Kit Tilly for helpful comments and suggestions regarding this study.
ESSENTIAL NATURE OF B. BURGDORFERI cp26 PLASMID
VOL. 186, 2004 REFERENCES
1. Austin, S., and K. Nordstro ¨m. 1990. Partition-mediated incompatibility of bacterial plasmids. Cell 60:351–354. 2. Barbour, A. G. 1993. Linear DNA of Borrelia species and antigenic variation. Trends Microbiol. 1:236–239. 3. Barbour, A. G. 1988. Plasmid analysis of Borrelia burgdorferi, the Lyme disease agent. J. Clin. Microbiol. 26:475–478. 4. Barbour, A. G., and C. F. Garon. 1987. Linear plasmids of the bacterium Borrelia burgdorferi have covalently closed ends. Science 237:409–411. 5. Baril, C., C. Richaud, G. Baranton, and I. Saint Girons. 1989. Linear chromosome of Borrelia burgdorferi. Res. Microbiol. 140:507–516. 6. Bono, J. L., A. F. Elias, J. J. Kupko III, B. Stevenson, K. Tilly, and P. Rosa. 2000. Efficient targeted mutagenesis in Borrelia burgdorferi. J. Bacteriol. 182:2445–2452. 7. Bono, J. L., K. Tilly, B. Stevenson, D. Hogan, and P. Rosa. 1998. Oligopeptide permease in Borrelia burgdorferi: putative peptide-binding components encoded by both chromosomal and plasmid loci. Microbiology 144:1033– 1044. 8. Burgdorfer, W., A. G. Barbour, S. F. Hayes, J. L. Benach, E. Grunwaldt, and J. P. Davis. 1982. Lyme disease—a tick-borne spirochetosis? Science 216: 1317–1319. 9. Casjens, S. 1999. Evolution of the linear DNA replicons of the Borrelia spirochetes. Curr. Opin. Microbiol. 2:529–534. 10. Casjens, S., M. Murphy, M. DeLange, L. Sampson, R. van Vugt, and W. M. Huang. 1997. Telomeres of the linear chromosomes of Lyme disease spirochetes: nucleotide sequence and possible exchange with linear plasmid telomeres. Mol. Microbiol. 26:581–596. 11. Casjens, S., N. Palmer, R. van Vugt, W. M. Huang, B. Stevenson, P. Rosa, R. Lathigra, G. Sutton, J. Peterson, R. J. Dodson, D. Haft, E. Hickey, M. Gwinn, O. White, and C. Fraser. 2000. A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35:490– 516. 12. Chaconas, G., P. E. Stewart, K. Tilly, J. L. Bono, and P. Rosa. 2001. Telomere resolution in the Lyme disease spirochete. EMBO J. 20:3229–3237. 13. de Silva, A. M., and E. Fikrig. 1995. Growth and migration of Borrelia burgdorferi in Ixodes ticks during blood feeding. Am. J. Trop. Med. Hyg. 53:397–404. 14. Eggers, C. H., M. J. Caimano, M. L. Clawson, W. G. Miller, D. S. Samuels, and J. D. Radolf. 2002. Identification of loci critical for replication and compatibility of a Borrelia burgdorferi cp32 plasmid and use of a cp32-based shuttle vector for expression of fluorescent reporters in the Lyme disease spirochaete. Mol. Microbiol. 43:281–295. 15. Elias, A. F., P. E. Stewart, D. Grimm, M. J. Caimano, C. H. Eggers, K. Tilly, J. L. Bono, D. R. Akins, J. D. Radolf, T. G. Schwan, and P. Rosa. 2002. Clonal polymorphism of Borrelia burgdorferi strain B31 MI: implications for mutagenesis in an infectious strain background. Infect. Immun. 70:2139– 2150. 16. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J.-F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M. D. Adams, J. Gocayne, J. Weidmann, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K. Horst, K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390: 580–586. 17. Gilmore, R. D., and J. Piesman. 2000. Inhibition of Borrelia burgdorferi migration from the midgut to the salivary glands following feeding by ticks on OspC-immunized mice. Infect. Immun. 68:411–414. 18. Grimm, D., K. Tilly, R. Byram, P. E. Stewart, J. G. Krum, D. M. Bueschel, T. G. Schwan, P. F. Policastro, A. F. Elias, and P. A. Rosa. 2004. Outersurface protein C of the Lyme disease spirochete: a protein induced in ticks for infection of mammals. Proc. Natl. Acad. Sci. USA 101:3142–3147. 19. Hinnebusch, B. J., Jr. 1991. Structure and replication of Borrelia burgdorferi linear plasmids. Ph.D. dissertation. University of Texas Graduate School of Biomedical Sciences at San Antonio, San Antonio. 20. Hinnebusch, J., and A. G. Barbour. 1992. Linear- and circular-plasmid copy numbers in Borrelia burgdorferi. J. Bacteriol. 174:5251–5257. 21. Hinnebusch, J., S. Bergstro ¨m, and A. G. Barbour. 1990. Cloning and sequence analysis of linear plasmid telomeres of the bacterium Borrelia burgdorferi. Mol. Microbiol. 4:811–820. 22. Hinnebusch, J., and K. Tilly. 1993. Linear plasmids and chromosomes in bacteria. Mol. Microbiol. 10:917–922. 23. Johnson, R. C. 1977. The spirochetes. Annu. Rev. Microbiol. 31:89–106. 24. Kobryn, K., and G. Chaconas. 2002. ResT, a telomere resolvase encoded by the Lyme disease spirochete. Mol. Cell 9:195–201. 25. Kolstø, A. 1997. Dynamic bacterial genome organization. Mol. Microbiol. 24:241–248.
3569
26. Krawiec, S., and M. Riley. 1990. Organization of the bacterial chromosome. Microbiol. Rev. 54:502–539. 27. Labandeira-Rey, M., and J. T. Skare. 2001. Decreased infectivity in Borrelia burgdorferi strain B31 is associated with loss of linear plasmid 25 or 28–1. Infect. Immun. 69:446–455. 28. Lawrenz, M. B., H. Kawabata, J. E. Purser, and S. J. Norris. 2002. Decreased electroporation efficiency in Borrelia burgdorferi containing linear plasmids lp25 and lp56: impact on transformation of infectious Borrelia. Infect. Immun. 70:4851–4858. 29. Marconi, R. T., M. E. Konkel, and C. F. Garon. 1993. Variability of osp genes and gene products among species of Lyme disease spirochetes. Infect. Immun. 61:2611–2617. 30. Margolis, N., D. Hogan, K. Tilly, and P. A. Rosa. 1994. Plasmid location of Borrelia purine biosynthesis gene homologs. J. Bacteriol. 176:6427–6432. 31. Morrison, T. B., Y. Ma, J. H. Weis, and J. J. Weis. 1999. Rapid and sensitive quantification of Borrelia burgdorferi-infected mouse tissues by continuous fluorescent monitoring of PCR. J. Clin. Microbiol. 37:987–992. 32. Ohnishi, J., J. Piesman, and A. M. de Silva. 2001. Antigenic and genetic heterogeneity of Borrelia burgdorferi populations transmitted by ticks. Proc. Natl. Acad. Sci. USA 98:670–675. 33. Purser, J. E., M. B. Lawrenz, M. J. Caimano, J. D. Radolf, and S. J. Norris. 2003. A plasmid-encoded nicotinamidase (PncA) is essential for infectivity of Borrelia burgdorferi in a mammalian host. Mol. Microbiol. 48:753–764. 34. Purser, J. E., and S. J. Norris. 2000. Correlation between plasmid content and infectivity in Borrelia burgdorferi. Proc. Natl. Acad. Sci. USA 97:13865– 13870. 35. Ravin, N. V. 2003. Mechanisms of replication and telomere resolution of the linear plasmid prophage N15. FEMS Microbiol. Lett. 221:1–6. 36. Ravin, N. V., T. S. Strakhova, and V. V. Kuprianov. 2001. The protelomerase of the phage-plasmid N15 is responsible for its maintenance in linear form. J. Mol. Biol. 312:899–906. 37. Rosa, P., D. S. Samuels, D. Hogan, B. Stevenson, S. Casjens, and K. Tilly. 1996. Directed insertion of a selectable marker into a circular plasmid of Borrelia burgdorferi. J. Bacteriol. 178:5946–5953. 38. Rybchin, V. N., and A. N. Svarchevsky. 1999. The plasmid prophage N15: a linear DNA with covalently closed ends. Mol. Microbiol. 33:895–903. 39. Sadziene, A., B. Wilske, M. S. Ferdows, and A. G. Barbour. 1993. The cryptic ospC gene of Borrelia burgdorferi B31 is located on a circular plasmid. Infect. Immun. 61:2192–2195. 40. Samuels, D. S. 1995. Electrotransformation of the spirochete Borrelia burgdorferi. Methods Mol. Biol. 47:253–259. 41. Schwan, T. G., W. Burgdorfer, and C. F. Garon. 1988. Changes in infectivity and plasmid profile of the Lyme disease spirochete, Borrelia burgdorferi, as a result of in vitro cultivation. Infect. Immun. 56:1831–1836. 42. Schwan, T. G., and J. Piesman. 2000. Temporal changes in outer surface proteins A and C of the Lyme disease-associated spirochete, Borrelia burgdorferi, during the chain of infection in ticks and mice. J. Clin. Microbiol. 38:382–388. 43. Schwan, T. G., and J. Piesman. 2002. Vector interactions and molecular adaptations of Lyme disease and relapsing fever spirochetes associated with transmission by ticks. Emerg. Infect. Dis. 8:115–121. 44. Schwan, T. G., J. Piesman, W. T. Golde, M. C. Dolan, and P. A. Rosa. 1995. Induction of an outer surface protein on Borrelia burgdorferi during tick feeding. Proc. Natl. Acad. Sci. USA 92:2909–2913. 45. Stevenson, B., T. G. Schwan, and P. A. Rosa. 1995. Temperature-related differential expression of antigens in the Lyme disease spirochete, Borrelia burgdorferi. Infect. Immun. 63:4535–4539. 46. Stewart, P., G. Chaconas, and P. Rosa. 2003. Conservation of plasmid maintenance functions between linear and circular plasmids in Borrelia burgdorferi. J. Bacteriol. 185:3202–3209. 47. Stewart, P. E., R. Thalken, J. L. Bono, and P. Rosa. 2001. Isolation of a circular plasmid region sufficient for autonomous replication and transformation of infectious Borrelia burgdorferi. Mol. Microbiol. 39:714–721. 48. Tilly, K., S. Casjens, B. Stevenson, J. L. Bono, D. S. Samuels, D. Hogan, and P. Rosa. 1997. The Borrelia burgdorferi circular plasmid cp26: conservation of plasmid structure and targeted inactivation of the ospC gene. Mol. Microbiol. 25:361–373. 49. Tilly, K., A. F. Elias, J. L. Bono, P. Stewart, and P. Rosa. 2000. DNA exchange and insertional inactivation in spirochetes. J. Mol. Microbiol. Biotechnol. 2:433–442. 50. Tilly, K., A. F. Elias, J. Errett, E. Fischer, R. Iyer, I. Schwartz, J. L. Bono, and P. Rosa. 2001. Genetics and regulation of chitobiose utilization in Borrelia burgdorferi. J. Bacteriol. 183:5544–5553. 51. Tilly, K., L. Lubke, and P. Rosa. 1998. Characterization of circular plasmid dimers in Borrelia burgdorferi. J. Bacteriol. 180:5676–5681. 52. Tourand, Y., K. Kobryn, and G. Chaconas. 2003. Sequence-specific recognition but position-dependent cleavage of two distinct telomeres by the Borrelia burgdorferi telomere resolvase, ResT. Mol. Microbiol. 48:901–911. 53. Zhou, X., M. Cahoon, P. Rosa, and L. Hedstrom. 1997. Expression, purification, and characterization of inosine 5⬘-monophosphate dehydrogenase from Borrelia burgdorferi. J. Biol. Chem. 272:21977–21981.
